Labshake search
Citations for Roche :
3901 - 3950 of 8217 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Cells were lysed in 1% Triton X-100 with protease inhibitor (Roche). Lysates were centrifuged for 1 h at 4°C ...
-
bioRxiv - Biophysics 2024Quote: ... 1 µM ATP and 0.01% Nonidet P-40 Substitute (NP-40, Roche); MB-no-ATP ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... supplemented with 1× cOmplete™ EDTA-free Protease Inhibitor Cocktail Tablets (Roche)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... dry milk or 2% BSA (Roche), membranes were probed with primary antibody (dilution 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% BSA fraction V (Roche Diagnostics), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Immunology 2021Quote: ... 2 mg/mL Collagenase VIII (Roche) and 0.5 mg/mL DNAse I (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 pg of E.coli rRNA (Roche) was added as spike-in to equal volumes of RNA extracted from sucrose gradient fractions for the reverse transcription ...
-
bioRxiv - Bioengineering 2021Quote: ... and 30U/ml hIL-2 (Roche). After 2 days ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of DNase I (Roche), and 1 μl of RNase OUT (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... 2 mg/ml collagenase D (Roche), and 1.5 mg/ml DNase I (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL] ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL solution] at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... we used 2% Blocking Reagent (Roche) in PBS with 0.1% Tween-20 ...
-
bioRxiv - Immunology 2020Quote: ... + 2 U/mL DNAse I (Roche), shaking at 200 rpm for 45 mins – 1 hour at 37 °C ...
-
The transcription factor RUNX2 drives the generation of human NK cells and promotes tissue residencybioRxiv - Immunology 2022Quote: ... collagenase D (2 mg/mL, Roche) and Dnase I (0.2 mg/mL ...
-
bioRxiv - Developmental Biology 2020Quote: ... in 2% blocking solution (Roche 11096176001) were used for RNA probe detection ...
-
bioRxiv - Immunology 2021Quote: ... 2 mg/mL collagenase A (Roche), and 2 mg/mL collagenase D (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... 2 mg/mL Collagenase VIII (Roche) and 0.5 mg/mL DNAse I (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2× complete protease inhibitor cocktail (Roche, Sigma/Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μg of DNase I (Roche) treated RNA was converted to cDNA using BioScript Reverse Transcriptase (Bioline ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 “Complete” protease inhibitor tablets (Roche), 25 μg/mL lysozyme (Gold Biochem ...
-
bioRxiv - Genetics 2023Quote: ... and 2% protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Immunology 2022Quote: ... IL-2 (50 IU/ml) (Roche) and glucose (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 cOmplete Protease Inhibitor tablets (Roche)) ...
-
bioRxiv - Immunology 2024Quote: ... Liberase TL (2 U/ml; Roche) and DNAse1 (160 U/ml ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2% pronase (Roche, Basel, Switzerland). Cells were passed through a 70 μm cell strainer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... #2 and #ref were from Roche.
-
Decreased Astrocytic CCL5 by MiR-324-5p Ameliorates Ischemic Stroke Injury via CCR5/ERK/CREB PathwaybioRxiv - Neuroscience 2024Quote: ... 2 μg/μl CCL5 antibody (Roche), or 20 ng/μl recombinant mouse CCL5 (Absin) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2× HotStart Ready Mix (Roche, KK2601) was used for PCR amplification ...
-
bioRxiv - Cell Biology 2024Quote: ... 2×cOmplete Protease Inhibitor Cocktail (Roche), and 1% n-dodecyl-β-maltoside (DDM) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland).
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche). After centrifugation at 400g for 5 min at 40C ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were fixed with 2% paraformaldehyde/ 2% sucrose for 20 min and stained with DAPI (#10236276001, Roche) to visualize anaphases ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% FBS and 0.1% Insulin-transferrin-selenium (Roche)[14] ...