Labshake search
Citations for Roche :
3851 - 3900 of 4283 citations for Mouse Anti Dengue Virus Serotype 2 NS1 Antibody CM474 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
bioRxiv - Biochemistry 2022Quote: ... pellets were resuspended in lysis buffer (50 mM HEPES pH 8, 400 mM NaCl, 75 mM Imidazole pH 8, 5% v/v glycerol, 5 mM 2-Mercaptoethanol, supplemented with Roche Protease Inhibitor Tablets) and lysed using an Emulsiflex-05 homogenizer ...
-
bioRxiv - Cell Biology 2021Quote: ... using 2 μL of the diluted cDNAs and the KAPA SYBR ® FAST qPCR Kit Optimized for Light Cycler ® 480 (KAPA biosystems). Differences between samples and controls were calculated based on the 2−ΔCT method ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 12.5 ng of purified DNA from each sample was used as a template for PCR amplification in 25 μl reaction mixture by using 2 × KAPA HiFi Hot Start Ready Mix (Kapa Biosystems, MA, USA). For PCR amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed adding 2 μl of DNAse-treated RNA to 17 μl reaction mixture containing 1X Expand Reverse Transcriptase Buffer (Roche Diagnostics, Mannheim, Germany), 10mM of Dithiothreitol (DTT ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK293 cells were transiently transfected with β-arrestin 2-Renilla luciferase 8 (Rluc8) and human C5aR2-Venus constructs using XTG9 (Roche, Sydney, Australia) for 24 h ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in SDS-PAGE loading buffer (50 mM TrisC1 pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 4% β-mercaptoethanol, 1 mM PMSF, 1x Roche cOmplete protease inhibitor cocktail) and boiled for 10 min ...
-
bioRxiv - Physiology 2020Quote: ... finely cut with scissors and incubated in digestion medium (PBS with 2% BSA, 1M CaCl2, 94U/ml dispase II and 100mg/ml collagenase D, Roche Life Science, France) at 37°C for 30-40min ...
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates were extracted with phosphate-buffered saline (PBS) containing 2 % Triton X-100 and protease inhibitors (Roche Complete, Roche Diagnostics, Mannheim, Germany). Protein concentrations were determined by BCA-assay (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Plant Biology 2024Quote: ... was performed in 2-day-old cells according to the manufacturer’s protocol (TMR red in situ cell death detection kit, Roche Diagnostics GmbH, Heidelberg, Germany) with modifications as described earlier (Smetana et al. ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Two mL of nuclear lysate from suspension culture of HeLa cells at protein concentration of 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland,05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Cell Biology 2024Quote: Four mL of nuclear lysate from suspension culture of HeLa cells at protein concentration 2.5 mg/mL were prepared in buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, cOmplete (La Roche Ltd., Basel, Switzerland, 05056489001) and PhosStop RNase inhibitors (La Roche Ltd. ...
-
bioRxiv - Biochemistry 2024Quote: ... was washed once with 80 mL of lysis buffer 1 (20 mM Tris-HCl, pH 8.0) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Microbiology 2023Quote: Capture-based libraries were prepared following the KAPA RNA HyperCap workflow with specific enrichment probes for SARS-CoV-2 (Roche Diagnostics, Mannheim, Germany). Each individual library was created using 10ul of extracted RNA input and following the protocol established by the kit’s manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Biophysics 2024Quote: ... Purified motor proteins were diluted to indicated concentrations in the assay buffer with 2 mM of corresponding nucleotides (ATP-Chem Imex, ADP-Sigma Aldrich, or AMPPNP-Roche Diagnostics GmbH)fr ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 50-200 mL of room temperature Ribosome Lysis Buffer supplemented with 2 EDTA-free protease inhibitor tablets (Roche, Catalog Number 04693132001), Turbo DNAse (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 100-200 mL of room temperature eIF3 Lysis Buffer supplemented with 2 ethylenediamine tetraacetic acid (EDTA)-free protease inhibitor tablets (Roche, Catalog Number 04693132001), 20 mM imidazole ...
-
bioRxiv - Cancer Biology 2024Quote: ... To maintain the carryover ≤ 20% with intra-day and inter-day (2 d) CV%≤ 20% acceptable for bioanalytical assays ((Clouser-Roche et al., 2008), it was necessary to perform intermediate a post-run wash injection following each standard and sample injection ...
-
bioRxiv - Microbiology 2024Quote: ... 12 ng of genomic DNA was amplified in a 25 µL reaction comprised of 2x Kapa HiFi Master Mix (Roche cat # KK2601/2), 1 µL of 10 µM V4 515F/806R primers with Illumina adapters (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGYCAGCMGCCGCGGTAA -3’ ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was discarded and the pure nuclear pellets were resuspended in boiling buffer (100mM Tris pH8.0, 2% SDS, 100μM PUGNAc, and Roche EDTA-free protease inhibitor cocktail) [59] ...
-
bioRxiv - Cell Biology 2019Quote: Antibodies used for immunofluorescence (IF) experiments in this study were: HA tag (Roche, 3F10/11 867 423 001), giantin (Santa Cruz ...
-
bioRxiv - Cancer Biology 2020Quote: ... The expression of KZFP was verified by western blotting with the HA-specific antibody (Roche, Basel, Switzerland; #12013819001). Empty vector-transduced A549 cells (referred to as negative control cells (NC cells) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were then stained for HMGXB4-HA and HMGXB4SUMO -HA using a HA tag antibody (Roche Applied Science) and Fibrillin with Anti-Fibrillin 1 antibody (abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... The detection kit for the antibodies is the UltraView DAB detection Kit (Ventana Medical Systems Inc./ Roche Diagnostic). A counter-staining of the nuclei was used for 12 minutes by Hematoxylin ...
-
bioRxiv - Microbiology 2019Quote: ... The HA epitope was detected using horseradish peroxidase (HRP)-conjugated HA antibody (Roche; catalog no. 12013819001 ab 3F10). SAG2 and DP1 were recognized by rabbit polyclonal anti-SAG2 (generated previously (34) ...
-
bioRxiv - Plant Biology 2019Quote: ... and incubated with anti-c-Myc primary antibody solution (GenScript, 1: 2,000 dilution in 1×TBS-T with 0.2% Blocking Reagent [Roche]) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Input and antibody-bound fractions were quantified by real-time PCR amplification with the SYBR Green mixture (Roche) using a LightCycler 480II (Roche ...
-
bioRxiv - Plant Biology 2019Quote: ... and incubated with anti-Mouse IgG-HRP secondary antibody solution (Sigma, 1:10,000 dilution in 1×TBS-T with 0.2% Blocking Reagent [Roche]) for 1-2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: ... was used to remove excess antibody and amplified C-circles were detected with CDP-Star® kit (Roche). Membranes were imaged with the Odyssey® Fc Imager (LI-COR ...
-
bioRxiv - Genetics 2023Quote: ... Cells were incubated overnight in primary antibodies targeting GFP to stain GFP labelled CTCF or RAD21 (Roche, 11814460001) or SON (abcam ...
-
bioRxiv - Immunology 2023Quote: ... in antibody buffer (20 mM HEPES pH 7.5; 150 mM NaCl; 0.5 mM Spermidine; 1X Protease inhibitor cocktail (Roche); 0.05% Digitonin ...
-
bioRxiv - Cell Biology 2022Quote: ... 20% of the elution sample volume was analyzed by western blotting with α-HA tag antibody (#3F10, Roche) for Sly1-HA immunodetection.
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was first performed with high or low pH buffer depending on the primary antibody (CC1m, Roche or low pH antigen retrieval buffer ...
-
bioRxiv - Immunology 2023Quote: ... sorted cells were washed with PBS and resuspended in Antibody Buffer (1X eBioscience Perm/Wash Buffer, 1X Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche, Mannheim, Germany, code#06402712001), 2 μl diluted reverse transcriptase product (1:100) ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Neuroscience 2019Quote: 88 μL of sample was subjected to RNase-free DNaseI treatment by the addition of 10 μL of 10X Buffer and 2 μL of RNase-free DNaseI (Roche 04 716 728 001) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science, Mannheim, Germany) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...