Labshake search
Citations for Roche :
3751 - 3800 of 5627 citations for Total Carbohydrate Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Messenger RNA library construction was performed using the Kapa HyperPrep mRNA Stranded with Riboerase kit (Roche). Each indexed sample was pooled in equimolar amounts and sequenced on one lane of HiSeq4000 by Novogene.
-
bioRxiv - Microbiology 2021Quote: Sequencing libraries were constructed using the KAPA RNA HyperPrep kit following manufacturer’s protocol (Roche Sequencing Solutions). To enrich for SARS-CoV-2 sequence ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the cDNA library was constructed with the KAPA stranded RNA-seq kit (KAPA biosystems KK8400) according to manufacturer’s protocol with Illumina Truseq forked adapters ...
-
bioRxiv - Cancer Biology 2022Quote: ... Purified libraries were normalized by quantitative PCR (qPCR) using the KAPA Library Quantification Kit (KAPA Biosystems) and diluted to a final concentration of 10 nM ...
-
bioRxiv - Microbiology 2022Quote: ... Cell-clone colonies were tested for β-galactosidase expression to check viral infectivity (kit Roche #11758241001). Positive clones were transduced with the lentiviral vector (LV ...
-
bioRxiv - Molecular Biology 2022Quote: ... The purified pool was quantified by real-time PCR with the Kapa Biosystems Quantification Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: DNA from liver and cell pellets was isolated using High Pure PCR Template Preparation Kit (Roche). DNA concentrations were measured by Nanodrop 2000c Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR was conducted with the LightCycler 480 SYBR Green I Master kit (Cat. 04887352001, Roche). Primers used for qRT-PCR are listed in Supplementary Table 2 ...
-
RTEL-1 and DNA polymerase theta promote subtelomeric DNA synthesis and telomere fusion in C. elegansbioRxiv - Genetics 2022Quote: ... Probe was generated using the PCR DIG probe synthesis reaction kit (Roche cat# 11636090910, Basel, Switzerland). Tel2 (GAATAATGAGAATTTTCAGGC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Messenger RNA library construction was performed using the Kapa HyperPrep mRNA Stranded with Riboerase kit (Roche). Each indexed sample was pooled in equimolar amounts and sequenced on two lanes of a NovaSeq4000 with paired end 150 bp reads at the UT Arlington North Texas Genome Center ...
-
bioRxiv - Microbiology 2022Quote: ... Viral DNA was then extracted using the High Pure Viral Nucleic Acid Kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... and concentrations were determined using the Kapa SYBR FAST Universal qPCR kit for Illumina sequencing (Roche). Paired-end 75 cycle sequencing was completed using two Mid Output 150 cycle kits on the NextSeq 550 (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... DNA fragmentation was evaluated using a Cellular DNA Fragmentation ELISA Kit (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... The purified PCR products were used to construct libraries by the Kapa DNA Hyper Kit (Roche) together with TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: To detect DNA fragmentation in GFAP+ astrocytes an in situ cell death detection kit (Roche, 11684795910) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... Sst sense and antisense probes were transcribed using a DIG or FITC RNA labeling kit (Roche) and purified with RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Neuroscience 2023Quote: RNA-Seq library was prepared using the KAPA Stranded RNA-Seq Kit with RiboErase (Kapa Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... The libraries were prepared using the KAPA stranded RNA-seq Kit with RiboErase (HMR) (KAPA-Roche) following the protocol provided in the Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... and used as a template for antisense probe synthesis using a DIG RNA labeling kit (Roche) and Sp6 polymerase (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: Cell death was determined by lactate dehydrogenase (LDH) activity using a Cytotoxicity Detection Kit (LDH) (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stranded mRNA-Seq libraries were prepared with KAPA mRNA HyperPrep Kit for Illumina® Platforms (Roche). Paired-ends reads of 2×100 base pairs were sequenced on Illumina NoveSeq6000 at the National Center for Medical Genomics in Prague according to manufacturer protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were then quantified by qPCR using the KAPA Library Quantification Kit KK4835 (REF. 07960204001, Roche) prior to amplification with Illumina’s cBot ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA synthesis was performed by reverse transcription using the Transcriptor High Fidelity cDNA-Synthesis Kit (Roche) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The pooled library was quantified using KAPA Library Quantification Kit (Kapa Biosystems, Cape Town, South Africa) diluted and denatured as the guideline of Illumina’s sequencing library preparation ...
-
bioRxiv - Systems Biology 2024Quote: ... strand-specific RNA-seq library was built with the KAPA RNA Hyper Prep kit (Kapa Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... qPCR was performed using the Light Cycler 480 SYBR green I Master kit (Roche, Cat# 04887352001). The primers used for RT-qPCR are listed in the Key Resource Table ...
-
bioRxiv - Plant Biology 2024Quote: ... Polymerase chain reactions (PCRs) were done employing the KAPA HiFi HotStart ReadyMix PCR Kit (#KK2601; Roche Sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AAV2 ITR specific probe was labeled using the DIG DNA labeling kit (11175033910, Roche, Switzerland) using the following oligonucleotide ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were equimolarly pooled and subjected to qPCR quantification using the KAPA library quantification kit (Roche). Sequencing was carried out on the NovaSeq 6000 instrument from Illumina based on a 2*100 cycle mode (paired-end reads ...
-
bioRxiv - Plant Biology 2024Quote: CUT&RUN and greenCUT&RUN libraries were constructed using the KAPA HyperPrep Kit (Roche Holding AG), with minor modifications ...
-
bioRxiv - Microbiology 2024Quote: ... . Apical wash and basolateral samples were assayed following protocol instructions (Cytotoxic Detection Kit, Roche Applied Science). To calculate absolute values ...
-
bioRxiv - Neuroscience 2024Quote: ... The libraries were quantified using the KAPA Library Quantification Kit - Illumina/ABI Prism User Guide (Roche Sequencing Solutions ...
-
bioRxiv - Microbiology 2024Quote: RNAs were extracted 48 hours after RNP transfection using the High Pure RNA Isolation Kit (Roche) according to instructions of the manufacturer ...
-
bioRxiv - Genomics 2024Quote: Shotgun sequencing libraries were prepared for each extract using the Hyper library construction kit (Kapa Biosystems). These libraries were sequenced using 150 bp paired-end reads on an S4 lane of an Illumina NovaSeq 6000 ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using FastStart SYBR Green Master kit (Roche, Indianapolis, IN).
-
bioRxiv - Pathology 2023Quote: ... The RNA-seq libraries were prepared with KAPA Stranded mRNA-Seq Illumina® Platforms Kit (Roche) following the manufactureŕs recommendations starting with 500 ng of total RNA as the input material ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified library was purified and then quantified using KAPA library quantification kit (#07960255001, Roche, Basel, Switzerland) and Bioanalyzer (Agilent technologies) ...
-
bioRxiv - Genetics 2024Quote: ... and PCR amplified using the KAPA HiFi Uracil PCR Kit (Catalogue Number: ROC-07959052001, Kapa Biosystems). The final libraries were assessed with the Agilent 2200 Tapestation System using D1000 Kit (Catalogue Number:5067-5582) ...
-
bioRxiv - Microbiology 2023Quote: ... Concentration of the pool was measured with quantitative PCR (KAPA Library Quantification Kit, Roche, Basel, Switzerland). Amplicon libraries were mixed with 5% PhiX and sequenced with MiSeq reagent kits v2 500 cycles (Illumina ...
-
bioRxiv - Pathology 2024Quote: ... and detection were performed using DIG High Prime DNA Labeling and Detection Starter Kit I (Roche) according to the instruction manual.
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... RNA was used to generate cDNA libraries using a KAPA mRNA HyperPrep Kit (Roche, Basel, Switzerland) on a Hamilton Starlet robotic platform (Hamilton Company ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The four paired-end libraries were quantified by qPCR using the KAPA Library Quantification Kit (Roche). Genome sequencing was conducted on the Illumina MiSeq platform at the Federal University of Rio Grande do Sul ...
-
bioRxiv - Developmental Biology 2024Quote: ... ST-HSCs and LT-HSCs using a KAPA RNA HyperPrep kit with RiboErase (HMR) (Kapa Biosystems) and sequenced using a Hiseq 1500 (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... The concentration of each library was examined by a KAPA library quantification kit (KK4809, Kapa Biosystems), and then the quantified libraries were pooled at 10 nM ...
-
bioRxiv - Cell Biology 2024Quote: RNA extraction from cultured cells has been performed using the High Pure RNA Isolation Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secreted calcitonin was measured by electrochemical luminescence immunoassay (ECLIA) using an Elecsys Calcitonin kit (Roche, Germany). Secreted CEA was measured by chemiluminescent microparticle immunoassay (CMIA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The qRT-PCR was performed using KAPA SYBR FAST qPCR Master Mix (2X) Kit (KAPA Biosystems) with StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The concentration of each library was determined using the KAPA Library Quantification Kit (Roche, Basel, Switzerland) for Illumina platforms ...
-
bioRxiv - Pathology 2023Quote: ... 2 canine gastrointestinal biopsies and 5 canine normal tissues (High Pure PCR Template Preparation Kit, Roche Applied Science ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with In Situ Cell Death Detection (TUNEL) Kit with TMR Red (Roche, 12156792910) according to the vendor’s instructions ...