Labshake search
Citations for Roche :
3651 - 3700 of 7401 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... wherein 1× KAPA HiFi HS Ready Mix (KAPA Biosystems) and 0.8 µM 1st PCR primer were included in a 25 μL reaction volume ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1:50 cOmplete proteinase inhibitor cocktail mix (Roche)) on ice for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (3F10; Roche Diagnostics, 1:1,000 dilution), mouse antiConnectin [C1.427 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM Na3VO4 and protease inhibitor cocktail (Roche, Germany). After centrifugation at 16,000xg for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... SYBR Green 1 Master (Cat# 4887352001, Roche Life science) was used to compare gene expression changes in VPRBP ...
-
bioRxiv - Immunology 2020Quote: ... 1 unit of AmpliTaq DNA polymerase (Roche Applied Science), 200 μM dNTP ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membranes were transferred onto 1× blocking buffer (Roche) and incubated at room temperature for 2-3 h ...
-
bioRxiv - Immunology 2021Quote: ... 20 µg.mL-1 of protease inhibitor cocktail (4693159001, Roche)] (10 mL per 1 L original culture) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were selected with 1 μg/ml Puromycin (Roche) and activated with IL-4 ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM PMSF and protease inhibitor mixture (Complete, Roche)) ...
-
bioRxiv - Immunology 2021Quote: ... and 30 U ml−1 DNase (Roche Diagnostics GmbH)) for 25 minutes in a shaking incubator at 37°C before being passed through a 100μm strainer followed by centrifugation at 300g for 5 mins ...
-
bioRxiv - Developmental Biology 2021Quote: ... sheep anti-digoxygenin-AP fab fragment 1:4000 (Roche). Alexa Fluor®-conjugated secondary antibodies were from Jackson Immuno Research ...
-
bioRxiv - Genomics 2021Quote: ... 1 U KAPA HiFi HotStart DNA Polymerase (KAPA Biosystems) in 1× HiFi Fidelity Buffer ...
-
bioRxiv - Genetics 2020Quote: ... 10 min DAPI staining (1:5000 in PBS; Roche) and 2 washes with 1xTBS ...
-
bioRxiv - Immunology 2023Quote: ... Dispase II (Roche; 1 mg/ml; cat. no. SCM133) and Dnase I (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1× blocking reagent (Roche; 11096176001) for 2 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... and 1 tablet of protease inhibitor (EDTA free, Roche). Resuspended cells were subjected to Nitrogen cavitation (Simpson ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 μL WST-1 (Roche, Sigma-Aldrich, USA) for 1 hour at 37° C in a humidified incubator with 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-GFP antibody (1:200, Roche, # 11814460001, Germany), TRITC-conjugated goat anti-rat antibody (1:200 ...
-
bioRxiv - Microbiology 2023Quote: ... 1% NP-40 and 1x protease inhibitors (Roche # 4693159001), followed by centrifugation at 1000 x g at 4° C ...
-
bioRxiv - Microbiology 2023Quote: ... 1% DDM and EDTA-free protease inhibitor cocktails (ROCHE)) and incubated for 30min at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... and 1:8000 secondary anti-DIG-PO antibodies (Roche) were added ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-DIG-POD (Roche Cat. N: 11207733910, 1:500) and Anti-FITC-POD (Roche Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mM NaF and protease inhibitor cocktail (Roche, 04693132001). After centrifuge at 4 ℃ ...
-
bioRxiv - Immunology 2023Quote: ... while stimulation with phytohemagglutinin (PHA, Roche, 1 μg/ml) was included as the positive control ...
-
bioRxiv - Microbiology 2023Quote: ... before application of Anti-His6-Peroxidase (Roche, 1:1000) in 5% (v/w ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 tablet of EDTA-free protease inhibitor tablet (Roche), and 1 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with DAPI solution (1:10, Roche). After washing ...
-
bioRxiv - Plant Biology 2023Quote: ... or GFP (diluted 1:1000, catalog no. 11814460001, Roche). Alkaline phosphatase conjugated anti-rabbit ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 tablet of complete protease inhibitor (Roche, 04693159001)] ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 250 U/mL DNase 1 (#10104159001, Roche, Switzerland) in a buffer containing HBSS with Ca2+/Mg2+ (#14205-050 ...
-
bioRxiv - Immunology 2023Quote: ... then enzymatically dissociated (0.05mg ml-1 Liberase DL (Roche), 0.05 mg ml-1 Liberase TL (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM EDTA with protease and phosphatase inhibitors (Roche)) was added to dissected and snap-frozen tissues at a ratio of 6 μL/mg of tissue ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100) supplemented with protease inhibitors (Roche). Immunoprecipitation ...
-
bioRxiv - Genetics 2023Quote: ... 1 mM EDTA) with complete protease inhibitors (PI, Roche) at 4ºC for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 1× protease and phosphatase inhibitor cocktails (Roche). Protein concentrations were obtained using the BCA Protein Assay Kit (Pierce ...
-
bioRxiv - Biochemistry 2023Quote: ... 1× cOmplete mini EDTA-free protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM DTT and Pierce® Protease Inhibitor (Roche). Thereafter ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 tablet “cOmplete” EDTA-free protease inhibitor (Roche) per 50 mL) ...
-
bioRxiv - Immunology 2023Quote: ... and collagenase D at 400 U ml-1 (Roche). After digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 x cOmplete protease inhibitor cocktail without EDTA (Roche), and 1 µM Cmd1 ...
-
bioRxiv - Genetics 2023Quote: ... 1:1000 anti-GFP antibody (Roche, # 11814460001, RRID: AB_390913) and 1:5000 goat anti-mouse IgG-HRP (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2023Quote: ... and labeled with anti-HA (1:1000, 1hr; Roche). HA-tagged CDPK1 in the cWT and cMut lines was visualized with secondary goat antibodies (1:2000 ...
-
bioRxiv - Genomics 2023Quote: ... protease inhibitors (1 tablet per 5 mL, Roche 4693159001)) was added to the embryo pellet ...
-
bioRxiv - Immunology 2024Quote: ... this contained 1× KAPA HiFi master mix (Roche, #KK2601), 0.5 μM Smart-seq3 forward primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCAATG ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.25 or 0.17 mg ml−1 Liberase (Roche Diagnostics). The digested lungs were passed through a 1 ml syringe to make single-cell suspensions ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% NP-40 with protease and phosphatase inhibitors (Roche). DRG were further lysate by sonicated (Vibra-Cell™ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% Triton X-100 and protease inhibitor tablets (Roche)) supplemented with 0.5% SDS and 0.2% n-lauroylsarcosine and sonicated using a Bioruptor (Diagenode ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-DIG AP antibody (Roche, Bâle, Switzerland, 1:4000) was added in fresh blocking solution and incubated at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM Na3VO4) supplemented with complete protease inhibitors (Roche) and the collected supernatant was used for western blotting ...