Labshake search
Citations for Roche :
3601 - 3650 of 3944 citations for Mouse anti Plasmodium vivax CSP PVC 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Fcgr1 mRNA signal was then detected using sheep anti-DIG antibody (1:500; Roche Diagnostics Corp., Indianapolis, IN) followed by the secondary antibody (Donkey anti-sheep IgG Alexa 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Developmental Biology 2019Quote: ... After a series of washes the probes were detected using FITC conjugated anti-Digoxigenin antibody (1:20, Roche) amplified with anti-sheep Alexa Fluor 488 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated for 1 h with rat anti-HA high affinity monoclonal antibodies (Roche Applied Science, Penzberg, Germany) at 1:500 ...
-
bioRxiv - Plant Biology 2019Quote: ... The presence of the proteins of interest was tested by immunodetection using rat anti-HA-peroxidase (3F10, Roche) or chicken anti-c-Myc primary antibody (A2128 ...
-
bioRxiv - Cancer Biology 2019Quote: All A673/TR/shEF in vitro and xenograft proteins were extracted with RIPA and anti-protease cocktail (Roche). Western blots were hybridized with rabbit monoclonal anti-FLI1 antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4 °C with alkaline phosphatase–conjugated anti-digoxigenin antibodies in TBTX (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Microbiology 2021Quote: ... and polymerized by UV light prior to labeling with anti-HA antibody (Roche, clone 3F10, 1:40 dilution) and 10nm gold bead conjugated goat anti-rat (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2020Quote: ... Detection of hybridized probes was performed with anti-DIG antibodies AP fragments (Roche, Basel Switzerland; dilution 1:1000) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and completed with anti-proteases (cOmplete™ ULTRA Tablets, Mini, EDTA-free, EASYpack Protease Inhibitor Cocktail, Roche®) and anti-phosphatases (PhosphoSTOP ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Neuroscience 2021Quote: ... In situ hybridization signals were detected with sheep anti-digoxigenin-AP Fab fragments (1:10000; Roche Diagnostics, Germany) conjugated with alkaline phosphatase ...
-
bioRxiv - Developmental Biology 2022Quote: ... blocked in TBTX/BSA/Sheep serum and then treated overnight with anti-DIG-AP antibody (1:2000; Roche). Following extensive washing in TBTX ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG was detected with anti-DIG Fab fragments conjugated to alkaline phosphatase (Roche, Indianapolis IN; 1:2000 dilution). Alkaline phosphatase activity was revealed using NBT/BCIP (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... the AAC2 variants were imported into Tom40-HA mitochondria followed by affinity purification via anti-HA beads (Roche) (18) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The bound ribopropbe was detected using an alkaline phosphatase-conjugated goat anti-DIG Fab fragment (1:750; Cat#: 11093274910, RRID:AB_514497; Roche) and the HNPP/FastRed detection kit (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 % blocking reagent before incubation in a blocking solution with anti-DIG alkaline phosphatase (AP) conjugated antibody (Roche) diluted 1 ...
-
bioRxiv - Cell Biology 2022Quote: ... the whole-cell extracts and immunoprecipitates were subjected to western blotting using monoclonal anti-GFP (JL-8, Roche), Flag-M2 monoclonal antibody (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Neuroscience 2024Quote: ... Detection of DIG-labeled probe was performed with a fluorescein-conjugated sheep anti-DIG antibody (1:250, Roche). All buffers were made with RNase-free PBS or water.
-
bioRxiv - Neuroscience 2023Quote: ... the brain sections were incubated with peroxidase (POD)-conjugated anti-FITC antibody (Roche Applied Science, Germany; 1:2,000) or POD-conjugated anti-Digoxigenin antibody (Roche Applied Science ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.15M NaCl) for 1 hour at R/T and then incubated with anti-DIG antibody (Roche; 1:5000) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Developmental Biology 2023Quote: ... Riboprobes produced as described above were detected using alkaline-phosphatase-conjugated anti-digoxigenin Fab fragments (1:2000, [Roche]). Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Neuroscience 2023Quote: ... brain sections were incubated with horseradish peroxidase (HRP)-conjugated anti-Dig (Roche Applied Science cat#11207733910, 1:500) and anti-GFP (Aves Labs cat#GFP-1010 ...
-
bioRxiv - Plant Biology 2023Quote: ... membranes were cut and immunodetected with either Horse Radish Peroxidase (HRP)-conjugated 3F10 anti-HA (1:2000, Roche) or HRP-conjugated Flag M2 (1:2000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation was performed at 4 °C for 1 h with pre-conjugated anti-HA affinity matrix (Roche 11815016001) or Anti-GFP Agarose (RQ2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: The following antibodies were used for immunoblots and immunoprecipitations: anti-HA as purified antibody or matrix (3F10, Roche), anti-FLAG as purified antibody or matrix (M2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 % BSA in PBS) for 1 h at room temperature before being incubated with rat anti-HA (Roche) diluted either 1:250 (tsA-201cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were incubated in primary antibody diluted in blocking buffer [rat anti-HA HRP 1:500 (Roche 12013819001), mouse anti-tubulin 1:1000 (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Biochemistry 2024Quote: ... HA- and GFP-tagged proteins were detected using horseradish peroxidase-conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: Western blots were carried out as described previously (Díaz-López et al., 2019) using the following primary antibodies: anti-EGFP (11814460001, Roche), anti-dsRed (a gift from José María Requena ...
-
bioRxiv - Neuroscience 2024Quote: The following primary antibodies and reagents were used in this study: rat anti-HA (Roche, 3F10, 1/1000), rabbit anti-GFP (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-sense RNA probes were transcribed from the DNA template using digoxigenin (DIG)-11-UTP Labelling Mix (Roche, UK), cleaned using spin filters (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were subsequently blocked in 1% fish-skin gelatin in PBS and grids were incubated in a 1:50 dilution of anti-GFP antibody (AB_390913, Roche) and labeled with 10 nm Protein A-gold particles (Utrecht Medical Center) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000; Roche). Primers used for generating PCR templates are listed in Key Resources Table.
-
bioRxiv - Genetics 2021Quote: ... Cell lysates were cleared by centrifugation at 13 000 g for 30 min and supernatants were incubated for 30 min with 2.5 μg/sample anti-HA antibodies (clone 3F10, Roche) bound to 50 μL/sample (or 1.5 mg/sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Developmental Biology 2020Quote: ... they were hybridized overnight at 65°C for three nights and incubated overnight with 1/2,000 alkaline-phosphatase conjugated with anti-DIG Fab fragment (Roche) at 4°C for three nights ...
-
bioRxiv - Molecular Biology 2021Quote: In situ antibody stainings were done as described previously 31 using rat anti-HA (MAb 3F10, 1:20; Roche), rabbit anti-FLAG (M2 ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was incubated with horseradish peroxidase (HRP)-conjugated rat anti-HA (clone 3F10) monoclonal antibodies (Roche, Indianapolis, IN) at a dilution of 1:5,000 for 2 hours ...