Labshake search
Citations for Roche :
3551 - 3600 of 6694 citations for HDM Fluorescent Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 30 ng of gDNA was enzymatically fragmented using the KAPA HyperPlus Kit (Roche). Samples were purified at 0.8X using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were quantified with KAPA Library Quantification Kit for Illumina (Kapa Biosystems, KK4873) and submitted to sequencing in NovaSeq 6000 System with 2 × 50 bp reads on SP flow cell.
-
bioRxiv - Cell Biology 2024Quote: ... were performed using the KAPA HiFi polymerase kit (Roche Sequencing Solutions, Pleasanton, CA) and a T100 Thermal Cycler (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from cells using High Pure Isolation Kit (Roche, 11828665001) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ChIP-seq DNA libraries were prepared using the KAPA HyperPrep Kit (Roche, # KK8504) and sequenced on the Illumina NextSeq 500 system ...
-
bioRxiv - Cancer Biology 2024Quote: Cell proliferation was measured by using the MTT assay kit (Roche, cat. 11465007001). Cells were cultured in 96-well plates at a density of 2000 cells per well overnight in an incubator with 5% CO2 at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Each DNA library was quantified using Roche KAPA Library Quantification Kit (Roche #0796014000) and pooled for sequencing on an Illumina NextSeq2500.
-
bioRxiv - Molecular Biology 2024Quote: ... and the KAPA RNA Hyper + RiboErase HMR kit was used (Roche, catalog 8098131702) following kit instructions for library prep using KAPA beads (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cell viability was analyzed using the XTT cell proliferation kit II (Roche Diagnostics). Drug treatment was started 24 h after cell seeding ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... converted to cDNA using KAPA mRNA HyperPrep kit (KAPA biosystems, Cat. No. KK8580), and indexed-adapter ligated with KAPA single-indexed adapter kit (KAPA biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... PCRs were performed using a KAPA SYBR FAST qPCR Kit (KAPA Biosystems, USA) with the Thermal Cycler Dice Real Time System (Takara) ...
-
bioRxiv - Cell Biology 2024Quote: ... the protocol from In Situ Cell Death Detection Kit (TMR Red, Sigma/Roche) was followed (Papagiannouli et al. ...
-
bioRxiv - Immunology 2024Quote: ... Amplified libraries were quantified using a KAPA SYBR Fast qPCR Kit (KAPA Biosystems) and its size distribution was analyzed by a MultiNA ...
-
bioRxiv - Immunology 2024Quote: ... the DNA libraries were prepared using the KAPA HyperPrep Kit (Roche, Basel, Switzerland) following the manufacturer’s instructions and sequenced on the Illumina NovaSeq platform with a 150 bp paired-end strategy ...
-
bioRxiv - Genetics 2024Quote: ... RNA sequencing libraries were prepared using the KAPA mRNA HyperPrep Kit V2 (Roche). Paired-end 100x100 bp sequencing was performed on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Genomics 2024Quote: ... PolyA-selected libraries were prepared using the KAPA stranded mRNA kit (Roche # 07962207001) and sequenced using the NOVASeq-S1 paired-end 100 platform ...
-
bioRxiv - Cell Biology 2024Quote: ... and quantified using the KAPA Library Quantification kit for ABI Prism (Roche, KK4854). ATAC libraries were pooled at equimolar ratios prior to sequencing in a HiSeq4000 instrument with paired-end 50bp reads at the Genomics Unit of the Centre for Genomic Regulation (Barcelona ...
-
bioRxiv - Genetics 2024Quote: ... and a KAPA SYBR FAST Universal qPCR Kit (Kapa Biosystems, Boston, MA, USA) were used ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The final indexed libraries were quantified using KAPA Library Quantification Kit (Roche 7960140001) for pooling and sequenced at 2x150 cycles on NovaSeq X Plus by Novogene.
-
bioRxiv - Microbiology 2024Quote: ... an equal volume of luciferase reagent (ATP Bioluminescence Assay Kit HS II, Roche) was added to each supernatant ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche, Mannheim, Germany, code#06402712001), 2 μl diluted reverse transcriptase product (1:100) ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Neuroscience 2019Quote: 88 μL of sample was subjected to RNase-free DNaseI treatment by the addition of 10 μL of 10X Buffer and 2 μL of RNase-free DNaseI (Roche 04 716 728 001) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Cell Biology 2020Quote: ... The buffers used in each step were supplemented with 1% (v/v) phosphatase inhibitor cocktail-2 and PhosSTOP (Roche: 1 tablet per 10 ml). Imaging of fixed samples was carried out on a Leica TCS SP8 MP microscope using oil immersion objective (HP CL APO CS2 63x/1.40 Oil) ...
-
bioRxiv - Genomics 2020Quote: ... the tissues were cut into 1-2 mm2 pieces and put in 1mg/ml collagenase and dispase (C/D) solution (Roche Diagnostics GmbH Roche Applied Science, Mannheim, Germany) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Cell Biology 2024Quote: ... a final concentration of 1 ng/μl cDNA was mixed with 2 μl FastStart DNA Master SYBR Green I (Roche #03 003 230 001), 0.5 μM forward and reverse primer ...
-
bioRxiv - Biochemistry 2024Quote: ... 250 mg of powder was thawed at 4°C followed by resuspension in 1 mL of HIP buffer (40 mM HEPES-KOH pH 7.5, 110 mM KOAc, 2 mM MgCl2, 1% Triton X-100, 0.1% Tween, 1x protease inhibitor cocktail [Roche], 1% solution P, 1 mM DTT). The lysate was next passed through a Whatman 25 mm GD/X Disposable filter (Cat No ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM NaCl, 0.1 mM EDTA, 10% [v/v] glycerol, 1% [w/v] digitonin, 2 mM PMSF, 1 x Roche EDTA free protease inhibitor cocktail). After removing the debris by a clarifying spin (12,000 x g ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cancer Biology 2023Quote: ... Fractions were supplemented with SDS (to a final concentration of 1%) and then digested with proteinase K (Roche, final concentration of 2 µg/ml) for 45 min at 42 C ...
-
bioRxiv - Biochemistry 2023Quote: ... and were resuspended in 30 mL lysis buffer 1 (50 mM sodium phosphate, 300 mM NaCl, pH 8) containing 2 mL of EDTA-free protease inhibitor mixture (Roche Applied Science, Penzberg, Germany). Cells were disrupted by passing the cell suspension three times through a Constant Cell disruption system (TS benchtop ...
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Genetics 2024Quote: ... 30 mM Tris-HCl, 20 mM KCl, 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 150 mM NaCl, cOmplete proteinase inhibitor [Roche Diagnostics, Indianapolis, IN, USA]), lysed by ultrasonic treatment and incubated with EZview anti-HA agarose beads (Sigma-Aldrich ...
-
bioRxiv - Physiology 2021Quote: ... PCR products were cleaned up using the High Pure PCR Product Purification Kit (Roche) and sequenced by LGC Genomics GmbH ...
-
bioRxiv - Microbiology 2020Quote: ... the super pools were quantified using the Kapa qPCR Illumina quantification kit (Kapa Biosystems) prior to sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Postamplification libraries were size selected at 250–450 bp in length using Agencourt AMPure XP beads from Beckman Coulter and were quantified using the Library Quantification Kit from Illiumina (Kapa Biosystems, KK4603). Libraries were pooled to a final concentration of 10nM and sequenced single-end using the Illumina HiSeq 4000.
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were generated using the Kapa RNA HyperPrep kit with RiboErase (HMR, Kapa Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tail genomic DNA was extracted using a KAPA mouse genotyping Kit (KAPA Biosystems KK7352), and PCR was performed using primers as described in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the Kapa Illumina GA with Revised Primers-SYBR Fast Universal kit (Kapa Biosystems). Average size fragment was determined using a LabChip GX (PerkinElmer ...
-
bioRxiv - Cell Biology 2020Quote: ... and apoeb transcripts were generated using the DIG RNA Labeling Kit (Roche Applied Science) from linearized plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... The rDNA and telomere probes were labeled by nick translation kit (Roche, Basel, Switzerland). The chromosome 3 painting probe was labeled with ATTO-550 as previously described (Albert et al. ...