Labshake search
Citations for Roche :
3501 - 3550 of 3754 citations for Mouse Anti Dengue Virus Membrane Protein Serotype 4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... followed by alkaline phosphatase-conjugated anti-rabbit secondary antibodies (1:5000) and CDP-Star (0.25 mM) according to the manufacturer’s instructions (Roche).
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Developmental Biology 2023Quote: ... Riboprobes produced as described above were detected using alkaline-phosphatase-conjugated anti-digoxigenin Fab fragments (1:2000, [Roche]). Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Neuroscience 2023Quote: ... brain sections were incubated with horseradish peroxidase (HRP)-conjugated anti-Dig (Roche Applied Science cat#11207733910, 1:500) and anti-GFP (Aves Labs cat#GFP-1010 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 mM b-mercaptoethanol (BME)] in the presence of an anti-protease cocktail (Complete EDTA-free, Roche) and 1 μl of benzonase (Merck Millipore ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were washed with 0.1% PBST and incubated with anti-Fluorescein-POD antibodies (1:500; Roche, #11426346910) in 1% blocking buffer overnight at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: The following antibodies were used for immunoblots and immunoprecipitations: anti-HA as purified antibody or matrix (3F10, Roche), anti-FLAG as purified antibody or matrix (M2 ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Embryos were incubated for 2-2.5 hours at room temperature with a rat anti-HA antibody (Roche, #11867423001) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Molecular Biology 2024Quote: Western blots were carried out as described previously (Díaz-López et al., 2019) using the following primary antibodies: anti-EGFP (11814460001, Roche), anti-dsRed (a gift from José María Requena ...
-
bioRxiv - Neuroscience 2024Quote: The following primary antibodies and reagents were used in this study: rat anti-HA (Roche, 3F10, 1/1000), rabbit anti-GFP (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-sense RNA probes were transcribed from the DNA template using digoxigenin (DIG)-11-UTP Labelling Mix (Roche, UK), cleaned using spin filters (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were subsequently blocked in 1% fish-skin gelatin in PBS and grids were incubated in a 1:50 dilution of anti-GFP antibody (AB_390913, Roche) and labeled with 10 nm Protein A-gold particles (Utrecht Medical Center) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS and 50 mM DTT with the addition of anti-protease (cOmplete cocktail, Roche 11 873 588 001). Samples were boiled 5 min at 95°C before loading on polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2021Quote: ... Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000; Roche). Primers used for generating PCR templates are listed in Key Resources Table.
-
bioRxiv - Genetics 2021Quote: ... Cell lysates were cleared by centrifugation at 13 000 g for 30 min and supernatants were incubated for 30 min with 2.5 μg/sample anti-HA antibodies (clone 3F10, Roche) bound to 50 μL/sample (or 1.5 mg/sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... they were hybridized overnight at 65°C for three nights and incubated overnight with 1/2,000 alkaline-phosphatase conjugated with anti-DIG Fab fragment (Roche) at 4°C for three nights ...
-
bioRxiv - Developmental Biology 2021Quote: ... blocked in 1xBM Blocking/PBST at RT for 2 hours and incubated with anti-DIG-POD (1:1,000, 11207733910, Roche) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: In situ antibody stainings were done as described previously 31 using rat anti-HA (MAb 3F10, 1:20; Roche), rabbit anti-FLAG (M2 ...
-
bioRxiv - Cell Biology 2019Quote: ... Beads were removed by centrifugation (twice at 1,000 xg) and then pre-cleared lysates were supplemented with anti-HA high affinity monoclonal antibody (clone 3F10, Roche) at 2 µg/ml final concentration along with 20 µl Protein G Sepharose beads and incubated at 4° C for 4 hours on a rotating wheel ...
-
bioRxiv - Molecular Biology 2019Quote: ... Supernatant was separated from lysates by centrifugation at 20,000×g for 10 minutes and used for immunoprecipitation using 20 µg of anti-GFP antibody (11814460001, Roche) (used for GFP-CENP-ACnp1 and Hap2-GFP IP ...
-
bioRxiv - Cell Biology 2019Quote: ... silanized slides and coverslips were assembled into chambers using double-sided tape and functionalized with anti-DIG IgG (Roche), then passivated with 1% Tween-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The signals were visualized with a nonradioactive detection system using anti-digoxigenin Fab fragment conjugated to alkaline phosphatase (Roche).
-
bioRxiv - Cancer Biology 2021Quote: GSDMB2-HA expression was analyzed by immunohistochemistry in 5µm-thick tissue sections using rat anti-HA (1:200; 3F10, ROCHE) or mouse monoclonal anti-GSDMB (1:10 ...
-
bioRxiv - Cell Biology 2021Quote: ... and thiamine-dependent repression was validated by immuno blotting of whole cell extracts using anti-HA antibodies (Roche, 3F10).
-
bioRxiv - Developmental Biology 2021Quote: ... 20% heat-inactivated goat serum and then incubated overnight with anti-DIG-AP antibody (Roche – 11093274910; 1:2,500 dilution) at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated with an anti-DIG antibody conjugated with horse radish peroxidase (HRP) (1/500, Roche Diagnostics) for 6 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: Antibodies used for western blots presented in this work were as follows: anti-HA monoclonal antibody (mAb) 3F10 (diluted 1:2,000) (Roche); mouse anti-GAPDH mAb (1:20,000) ...
-
bioRxiv - Microbiology 2022Quote: ... The membranes were then blocked for an hour in 5% milk powder/PBS solution and probed with 1:2,500 rat anti-HA mAb 3F10 antibody (Roche) in 5% milk powder/PBS solution overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... In situ hybridization signals in whole-mount embryos were detected using anti-DIG alkaline phosphatase (AP)-conjugated antibody (Roche) with an AP substrate ...
-
bioRxiv - Developmental Biology 2021Quote: ... The mRNA expression patterns were visualized by immunoreactivity with anti-digoxigenin horseradish peroxidase-conjugated Fab-fragments (Roche, Basel, Switzerland), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... ISH detection was performed using anti-DIG secondary antibody conjugated with radish peroxidase (POD) (Roche Diagnostics Corp., Indianapolis, IN) and Opal 570 (1:500 ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... The slides were incubated overnight with a 1:5,000 dilution of alkaline phosphatase-conjugated anti-DIG antibody (Roche Diagnostics). After the slides had been washed in in a solution of 0.1 M Tris (pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then washed in KPBS and incubated with rabbit anti-FG antibody (1:5000; Chemicon International, Calif, USA) in 0.5% Blocking Reagent (Roche) in KPBS for 16 h at 4 ° C ...
-
bioRxiv - Neuroscience 2022Quote: ... Digoxigenin probes were made by standard protocols and were detected using the anti-DIG POD antibody (Roche, 1:1000) and stained using Cy3-tyramide substrate (Perkin Elmer ...
-
bioRxiv - Cell Biology 2019Quote: ... and rat monoclonal anti-HA High Affinity for 60 minutes at room temperature (clone 3F10; 1:50 dilution, Roche). The sections were rinsed in PBS before incubation for 30 minutes with secondary Immunotech biotinylated antibody and 45 minutes with the Streptavidine-Peroxidase Complex (universal HRP immunostaining ...
-
bioRxiv - Plant Biology 2021Quote: ... SMXL5-3xHA and 6xMyc-OBE3 bands were detected by antibodies Anti-HA-Peroxidase High Affinity (3F10) (Roche; Basel, Switzerland) or c-Myc Antibody (9E10 ...
-
bioRxiv - Plant Biology 2020Quote: ... Pellets were resuspended in buffer (50mM Tris-HCl pH 7.0, 100 mM NaCl, and 1 tablet anti-protease cocktail (Roche) for 25 mL) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 20% heat-inactivated lamb serum in Tris-buffered saline with 0.1% Tween-20 (TBST) and incubated with alkaline phosphate-conjugated anti-DIG antibody (1:2000, Roche) in blocking buffer overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 2hr at room temperature and then incubated in blocking solution containing anti-Digoxigenin-AP antibody (1:2000; Roche) overnight at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... The isotypes of anti-Drosophila antibodies were determined by the IsoStrip™ Antibody Isotyping Kit (11493027001 Roche, Basel, Switzerland) according to the instructions of the manufacturer.
-
Zbtb14 regulates monocyte and macrophage development through inhibiting pu.1 expression in zebrafishbioRxiv - Developmental Biology 2022Quote: ... The probes labeled by digoxigenin were detected using alkaline phosphatase coupled anti-digoxigenin Fab fragment antibody (Roche, Basel, Switzerland) with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... samples were lysed in 1X RIPA lysis buffer containing anti-protease cocktail (cOmplete™, Mini Protease Inhibitor Cocktail, Roche) along with denaturing buffer supplied by NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... All co-cultures were fixed and post-fixed (before and after incubation with primary rat anti-HA antibody (Roche), respectively ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue was incubated with the probe overnight and Arc positive cells were detected with anti-digoxigenin-HRP conjugate (Roche Applied Science Ref # ...
-
bioRxiv - Biochemistry 2024Quote: ... Coverslips were then incubated with the anti-myc antibody (11667149001 9E10 mAb from Roche; 1:250 in blocking buffer) for two hours at room temperature ...