Labshake search
Citations for Roche :
3501 - 3550 of 7863 citations for 6 Chloro 1 phenylsulfonyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche, Mannheim, Germany, code#06402712001), 2 μl diluted reverse transcriptase product (1:100) ...
-
bioRxiv - Neuroscience 2019Quote: 88 μL of sample was subjected to RNase-free DNaseI treatment by the addition of 10 μL of 10X Buffer and 2 μL of RNase-free DNaseI (Roche 04 716 728 001) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1 x phosphatase inhibitor cocktail (PhosSTOP, Roche). Total protein concentration was determined with Bradford protein assay kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 μg ml−1 of DNase (Roche, #10104159001), 50 μg ml−1 of RNase (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse monoclonal to GFP (Roche #11814460001, 1:2000), Rabbit monoclonal to LRRK2 phospho-S1292 (Abcam #ab203181 ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... and 1 tablet of phosphatase inhibitor PhosSTOP (Roche)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM PMSF and protease inhibitor cocktail (Roche). Cells were scrapped and passed through a syringe with needle gauge 26 several times avoiding foam ...
-
bioRxiv - Cell Biology 2020Quote: ... rhodamine α-DIG Fab fragments (Roche 1:20) followed by Texas Red α-sheep antibody (Vector Labs ...
-
bioRxiv - Cell Biology 2019Quote: ... 1% Triton-X100 and protease inhibitors (Roche Diagnostics). of clarified lysate was obtained by centrifugation at 16,000xg 15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-GFP (1:200 dilution; Roche, 11814460001) was used for staining Cse4-GFP and rat anti-HA (1:200 dilution ...
-
bioRxiv - Developmental Biology 2021Quote: ... slides were blocked with 1% blocking reagent (Roche) for 1 h at RT ...
-
bioRxiv - Genetics 2020Quote: ... 1 mM EDTA and proteinase inhibitor (cOmplete, Roche) for 30 min at 4 °C on a rocking platform followed by centrifugation at 15,000 rpm for 15 min at 4 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 mg/ml yeast tRNA (Cat. # 10109509001, Roche), 1×Denhardt’s [1% (w/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1× complete protease inhibitor cocktail (Roche, Lot # 3024150)] ...
-
bioRxiv - Biophysics 2022Quote: ... 1 cOmplete EDTA free protease inhibitor tablet (Roche) per 50 ml Buffer L ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with collagenase (Roche, 11088793001, 1 mg/mL) and hyaluronidase (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 mM EGTA and protease inhibitors (Roche Diagnostics). For homogenization ...
-
bioRxiv - Molecular Biology 2020Quote: ... GFP 1:1000 dilution (Roche 11814460001 Lot# 27575600). After three five-min washes with gentle rotation in blocking buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 × cOmplete EDTA-free protease inhibitor cocktail (Roche) and 0.5 U/µl RNasin (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1×EDTA-free protease inhibitor cocktail (Roche) (Guo et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% glycerol) containing protease inhibitors (1:100, Roche) for 45 min on a rotor at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... Dispase II (Roche, 1 mg/ml, Cat. No.SCM133) and Dnase I (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... in the presence of 1 mM dATP (Roche) and 40 U of RNAseOUT (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.1% SDS containing protease inhibitors (1 tablet Roche cOmplete protease inhibitor cocktail (#11836145001 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.1% SDS) with protease inhibitors (1 tablet Roche cOmplete protease inhibitor cocktail per 25 ml of FA lysis buffer ...
-
bioRxiv - Pathology 2019Quote: ... containing 1× cOmplete™ Protease Inhibitor Cocktail (Roche), followed by 10sec homogenization using a ProScientific Bio-Gen Pro200 homogenizer.
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM PMSF and Complete (Roche, Branchburg, NJ) protease inhibitor cocktail) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cell proliferation was assessed using WST-1 (Roche) 48 h after seeding.
-
bioRxiv - Developmental Biology 2020Quote: ... and HA at 1:100 (Rat, Roche, #11867423001), V5 at 1:1000 (mouse ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% sodium deoxycholate and protease inhibitor cocktail (Roche)) and collected as the “DOC” ...
-
bioRxiv - Microbiology 2019Quote: ... 1 complete EDTA-free protease inhibitor tablet (Roche)) ...
-
bioRxiv - Neuroscience 2019Quote: ... and rat anti-HA (1:2,000, Roche, 11867431001). Secondary antibodies were Alexa 680 donkey anti-rat (Jackson ImmunoResearch ...
-
bioRxiv - Developmental Biology 2019Quote: ... Anti-DIG-AP antibody (1/1000, Roche 11093274910) diluted in MABT+2% BBR+20% FCS was then added for overnight at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM PMSF and protease inhibitors cocktail (Roche) and disrupted by sonication ...
-
bioRxiv - Cell Biology 2019Quote: ... or 1:2500 mouse anti-GFP antibodies (Roche) in 1× PBS-T (0.140 M NaCl ...
-
bioRxiv - Cell Biology 2019Quote: ... and 1% BSA (10 735 078 001, Roche). Primary antibodies (Table S1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-HA (1:100, from Roche #11867423001), rabbit anti-SALS (1:200 ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 x cOmplete protease inhibitor cocktail (Roche, 11836170001), 1mM PMSF (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 x cOmplete protease inhibitor cocktail (Roche, 11836170001), 1mM PMSF (Roche ...
-
bioRxiv - Biophysics 2021Quote: ... and 1 EDTA-free protease inhibitor tab (Roche)) and sonicated for a total of 2 minutes (20 sec on and 40 sec off intervals ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM PMSF and protease inhibitor cocktail (Roche). The Pierce BCA kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... 1 Unit Kapa HiFi polymerase (KK2102, Roche, UK), 1x Kapa HiFi Fidelity buffer (KK2102 ...