Labshake search
Citations for Roche :
3451 - 3500 of 9754 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 5 μg/mL PK (Roche, catalog number 03115852001) was added to the reactions and kept on ice for 10 min ...
-
bioRxiv - Physiology 2024Quote: ... with 2 mg/ml collagenase P (Roche, #11213873001) in the tube rotating at 40 rpm for 35 minutes at room temperature and washed two times in HBSS with 1% BSA ...
-
bioRxiv - Cell Biology 2024Quote: ... and PhosST0P (490684S00l, Roche, l tablet/l0 ml)) with the help of a cell scraper (on ice) ...
-
bioRxiv - Immunology 2024Quote: ... and 30 µg / mL of DNase I (Roche) and then processed into chunks using the lung_01 setting on a gentleMACS (Miltenyi Biotec) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6-mg/ml creatine kinase (Roche Molecular Biochemicals), 25-mM creatine phosphate (Roche Molecular Biochemicals ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP-40, 1 mM EDTA, 1 mM EGTA, 1 mM NaF, 1 mM sodium orthovanadate, 1 mM PMSF and Roche’s protease inhibitor tablet (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated in enzyme mix for tissue dissociation (collagenase type II enzyme mix (Gibco, 17101-015, 5mg/ml dissolved in Basis medium, DNase: 15ug/ml (Roche, 10104159001) and 10 μM Y-27632-HCl Rock inhibitor (Selleckchem ...
-
bioRxiv - Neuroscience 2022Quote: ... 93070) using a syringe plunger with 20 mL of 0.01M PBS and 0.01 mg/mL of papain (Roche, cat no. 10108014001), 0.05% collagenase (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... South Korea) was made in 10 ml per brain of digestion cocktail containing 0.5 mg/ml DNase I (Roche, Basel, Switzerland) and 1 mg/ml Collagenase A (Roche ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 mL of digestion Buffer containing collagenase D (2mg/mL, Roche #11088858001) and DNase (0.125 mg/mL ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated in enzyme mix for tissue dissociation (collagenase type II enzyme mix (Gibco, 17101-015, 5mg/ml dissolved in Basis medium, DNase: 15ug/ml (Roche, 10104159001) and 10 μM Y-27632-HCl Rock inhibitor (Selleckchem ...
-
bioRxiv - Molecular Biology 2021Quote: ... treated with 5.8 μl of proteinase K (24 mg/mL, P4850) for 45 min at 55°C followed by 50 μg/ml RNase A (Roche, 10109169001) for 1 h at 37°C plus 1 h at 65°C ...
-
bioRxiv - Immunology 2022Quote: ... We transferred the minced tissue to a tube containing 5 ml of digestion buffer containing collagenase D (2mg/ml, Roche #11088858001) and DNase (0.125 mg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... threshold values for biomarker aggregation also differ (amyloid-β: 192 pg/mL for INNO-BIA AlzBio3, 980 pg/mL for Roche Elecsys ...
-
bioRxiv - Cell Biology 2024Quote: ... deparaffinized microsections were rehydrated and incubated with hyaluronidase (4mg/mL in PBS, pH 5.5) followed by pronase (1mg/mL in PBS, pH 7.4, both Roche Diagnostics, Mannheim, Germany). After blocking with 5% bovine serum albumin sections were incubated with a mouse anti-human type II collagen antibody (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... South Korea) was made in 10 ml per brain of digestion cocktail containing 0.5 mg/ml DNase I (Roche, Basel, Switzerland) and 1 mg/ml Collagenase A (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Expi293F cell pellets (from 50 ml of culture) were thawed and resuspended in 8 ml of 0.25 x PBS with protease inhibitors (Roche, Indianapolis, USA). Cells were lysed using a Dounce homogenizer on ice and then centrifuged in a Beckman SW55 rotor at 100,000xg for 45 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Three trachea from either wild-type or Trp73-/- mice were pooled together in 15 mL falcon tubes containing 2 mL 0.15% filter sterilised Pronase (Roche, Basel, Switzerland) and incubated at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 μl papain inhibitor solution containing 5 mg/ml BSA (Carl Roth, 8076.4) and 5 mg/ml Trypsin inhibitor (Sigma-Aldrich/Roche, 10109878001) in PBS was added ...
-
bioRxiv - Immunology 2023Quote: ... 1 mg.mL-1 dispase (Roche, 04942078001) and 0.5 mg.mL-1 DNAseI (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... GATA3 (L50-823; 1:1; Roche), E-cadherin (612130 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were washed twice with 0.1% Triton-X in PBS and blocked with 3% BSA (constituted from powder BSA, Roche Fraction V ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5–10 × 106 HEK-293 or MEF cells were washed with cold sucrose-containing solution I (0.5 M sucrose, 3 mM MgCl2 with Cocktail protease inhibitor, Roche), harvested by scraping into 1 ml solution I and sonicated in a BioRuptor for 10 cycles (15 sec ON/15 sec OFF) ...
-
bioRxiv - Neuroscience 2019Quote: ... The plates were then washed 3 times with ~300 μl of wash buffer (0.05%Tween in PBS) and blocked with 150 μl of 3% BSA (Fraction V, protease-free, Roche Diagnostics Corporation ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were then washed 3 times for 5 min each in PBST and blocked with 1X Blocking Reagent (Roche) in PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... 12-20 ml of pre-warmed to 37 °C enzyme buffer solution (EBS) with 2.3 U of Liberase Blendzyme 3 recombinant collagenase (Roche) were cannulated into the vena cava to isolate hepatocytes ...
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sorted cells were pelleted for 5 min with 2000 rpm at 4°C and resuspended in 500 ul hypotonic buffer (HB; 20mM Tris-HCl, pH7.5, 10mM NaCl, 3 mM MgCl2) with added protease inhibitor (Roche). After 30min incubation on ice ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA (3–4 μg) was used to prepare cDNA with the Transcriptor First-Strand cDNA synthesis kit (Roche). qPCR was performed with TaqMan gene expression assay primers (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Cancer Biology 2024Quote: ... nuclei were isolated from 5 million cells with hypotonic buffer (20 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, protease inhibitors (Roche)) for 15 min on ice ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 μl of MNase buffer (0.3 M Sucrose, 85 mM Tris, 3 mM MgCl2, 2 mM CaCl2, 2.5U of micrococcal nuclease: Roche 10107921001) was added in to each tube (0.5 millions of cells per tube) ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.1% Triton X-100) with cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche, cat# 11873580001), 1 mM phenylmethylsµlfonyl fluoride (PMSF) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1 mM EDTA and 0.1% Triton X-100) supplemented with proteinase inhibitor mixture (cOmpleteTM; Roche), and incubated with 5 μg of histones in 250 μl of reaction buffer at 4°C for 2 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Captured peptides were then eluted from thiopropyl sepharose by incubation with 100 mM DTT (Roche) in 50 mM NH4HCO3 at 70°C for 45 minutes and further processed for mass spectrometry sequencing at the University of Cincinnati Proteomics Laboratory 67 ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 7.4 (Buffer A) with 0.5% Triton X-100 and Complete anti-protease (Roche, 11245200) was added to each plate ...
-
bioRxiv - Biochemistry 2019Quote: ... then protein was eluted with 100 µM imidazole in the presence of protease inhibitors (Roche) and desalted using a PD-10 column ...
-
bioRxiv - Cell Biology 2020Quote: ... 0,5% Triton X-100) supplemented with Complete Mini EDTA-free Protease inhibitor cocktail (Roche, 04693159001) and PhosSTOP (Phosphatase Inhibitor Cocktail (Roche ...