Labshake search
Citations for Roche :
301 - 350 of 3284 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and 0.5% deoxycholic acid containing Complete protease inhibitors (Roche) and PhosStop phosphatase inhibitors (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... resuspended in SDS-PAGE loading buffer (50 mM TrisC1 pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 4% β-mercaptoethanol, 1 mM PMSF, 1x Roche cOmplete protease inhibitor cocktail) and boiled for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Genomics 2021Quote: ... on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol in MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 300 mM MgAc ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellets were lysed in 200μL of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in buffer F (20 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 2 mM EGTA and Roche cOmplete protease inhibitor) and lysed by fluidizer ...
-
bioRxiv - Cell Biology 2022Quote: ... and then homogenized on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol with MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 3 mM MgAc ...
-
bioRxiv - Biophysics 2021Quote: ... Cell pellets were resuspended in Lysis Buffer (25 mM HEPES pH 8.0, 250 mM NaCl, 10 mM imidazole pH 8.0, 5 mM 2-mercaptoethanol, 10% glycerol and supplemented with Roche cOmplete protease inhibitor) and sonicated ...
-
bioRxiv - Physiology 2023Quote: ... autofluorescence was quenched by treating paraffin-embedded sections with PBS/BSA (5%) for 2 h before performing TUNEL staining (Roche, Basel, Switzerland) according to the manufacturer’s protocol and using Proteinase K treatment ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µl of the samples’ cDNA was mixed with 5 µl of FastStart SYBR Green Master (ROX; Hoffmann-La Roche, Basel, Switzerland), 0.25 µl of each primer (final concentration 500 nM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pellet was resuspended in Buffer B (10 mM Pipes, 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 2 mM PMSF, Roche protease inhibitor) with 1% Triton X-100 and incubated on ice for 1 hour ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR data were analyzed using LightCycler R 480 software (Roche). The relative expression levels of the gene of interest (GOI) ...
-
bioRxiv - Cell Biology 2024Quote: ... and a LightCycler® R 96 instrument (Roche Diagnostics, Basel, Switzerland) using specific primer sequences (supplementary Table S1) ...
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... total nucleic acid was extracted from 400 µl of cerebrospinal fluid using the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics, Indianapolis, IN, USA) on the MagNA Pure compact automated extractor ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 mg DNAse (Roche) and 4 mM MgCl2 was added and incubated for another hour ...
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl of 5 x KAPA HiFi buffer (Roche, #KK2101) and 16.75 µl H2O ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 mM ascorbic acid) containing a protease inhibitor cocktail (Roche). All subsequent steps were conducted on ice ...
-
bioRxiv - Plant Biology 2022Quote: ... and ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail cOmplete (Roche). For blocking and antibody dilutions ...
-
bioRxiv - Neuroscience 2021Quote: ... Okadaic acid (200nM) and a protease inhibitor cocktail (Roche Complete) with a Dounce homogenizer and solubilized for 1 hour rotating at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... 0.25% sodium deoxycholic acid and complete protease inhibitor cocktail (Roche), pH 7.5 ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Urine glucose levels were measured with a COBAS(r) 2000 analyzer (Roche). Blood glucose levels were measured using an “On Call GK dual” glucometer (Robe Medical ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were blocked in Blocking Buffer + Maleic Acid (Roche, 11585762001) for at least 3 hours before the anti-DIG antibody was added in a concentration of 1:5000 and incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5% deoxycholic acid) containing inhibitors of phosphatases (1:10 PhosphoStop; Roche) and proteases (1:100 Protease Inhibitor Cocktail ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by optional sialic acid removal using 0.02 U sialidase (Roche), prior to in-gel trypsin treatment49 ...
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Microbiology 2022Quote: ... 0,002% mellitic acid and 1 pastil of protease inhibitors cocktail (Roche)).
-
bioRxiv - Neuroscience 2021Quote: ... 25 nM okadaic acid and a protease inhibitor cocktail tablet (Roche). Soluble and insoluble fractions of total homogenates were obtained as previously described (30) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche diagnostics, GmbH), pH 8) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 tablet crushed complete EDTA (ethylenediaminetetraacetic acid)-free protease inhibitor (Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Neuroscience 2023Quote: ... and ethylenediaminetetraacetic acid-free Complete Protease Inhibitor Cocktail (Roche Applied Science). After centrifugation at 20,000[×[g for 30 min at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Detection was accomplished using the DIG Nucleic Acid Detection Kit (Roche). Images were quantified using ImageJ ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4-toluidine salt (BCIP, Roche) in NTMT buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Microbiology 2023Quote: ... 4 U DNase I (Roche) with the reaction buffer provided with the enzyme for 20 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4×PIC (Roche; Cat#05056489001)) was added to the pellets ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 mM ATP (Roche, 10519979001)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Version 4 (Roche, Mannheim, Germany), using MagNa Lyser Green Beads (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...