Labshake search
Citations for Roche :
301 - 350 of 5638 citations for QuantiFluo Protein Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and qPCR assays were carried out in a LightCycler96 system (Roche), using MESA BLUE qPCR kit for SYBR assay (Eurogentec ...
-
bioRxiv - Microbiology 2022Quote: ... HBeAg was detected using the Elecsys HBeAg assay (Roche, Meylan, France). Lumipulse® G HBcrAg assay (Fujirebio ...
-
bioRxiv - Immunology 2023Quote: ... glucose were measured by automated enzymatic colorimetric assay (Cobas, Roche, Germany). The area under the curve (AUC ...
-
bioRxiv - Molecular Biology 2022Quote: ... ATP concentration was determined by ATP bioluminescence assay (Roche, Tucson, AZ) following the manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the Luciferase Reporter Gene Assay according to manufacturer’s instructions (Roche). Hep3B cells were stimulated with human IL-6 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Maltose binding protein/hemagglutinin-tagged Nuku proteins were detected using an anti-HA peroxidase-conjugated monoclonal rat antibody (3F10; 12013819001 (Roche)).
-
bioRxiv - Genetics 2022Quote: ... MYC-tagged or FLAG-tagged recombinant proteins were captured using ~5μg antibody and Protein-Agarose beads (Roche Applied Science, 11243233001) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... 25 μL of Protein G agarose beads (Roche) were placed into each IP sample and incubated o/n at 4 °C on a rotator ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein was digested with AspN protease (Roche) at 30°C for 16 hr ...
-
bioRxiv - Plant Biology 2019Quote: ... and a protein phosphatase inhibitor tablet (PhosSTOP, Roche). Protein samples were analysed by Western blot with a mouse anti-GFP HRP-conjugated antibody.
-
bioRxiv - Plant Biology 2019Quote: ... and a protein phosphatase inhibitor tablet (PhosSTOP, Roche). After centrifuge ...
-
bioRxiv - Plant Biology 2019Quote: ... and a protein phosphatase inhibitor tablet (PhosSTOP, Roche). After addition of half a volume of SDS loading dye ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein bands were detected using Lumi-Light (Roche) chemiluminescence kit as per the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2021Quote: ... 1x protein inhibitor cocktail (cOmplete, Roche; added fresh), 300μg/ml lysozyme ...
-
bioRxiv - Plant Biology 2021Quote: ... and a protein phosphatase inhibitor tablet (PhosSTOP, Roche). After addition of SDS loading buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were transferred onto Polyvinylidenfluorid (PVDF) membranes (Roche), blocked with 5% dry milk for 1 hour and incubated with primary antibodies overnight at 4°C ...
-
bioRxiv - Plant Biology 2019Quote: ... GUN1 protein was expressed in RTS ProteoMaster (Roche). Full-length GUN1 cDNA and N-terminal truncated versions as EcoRI-SalI PCR fragments were ligated into pET48b (Novagen ...
-
bioRxiv - Molecular Biology 2019Quote: ... protein was degraded by Proteinase K (3115879001, Roche), and a phenol/chloroform/isoamyl alcohol DNA extraction ...
-
bioRxiv - Cell Biology 2019Quote: ... A Protein A agarose bead slurry (Sigma-Roche) (60ul ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein-G agarose beads were manufactured by Roche and purchased from Sigma Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... 750 μL of Protein G Agarose beads (Roche) were used to capture 400 μL of SUMO-2/3 antibody (8A2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein-G agarose beads were manufactured by Roche. All other reagents were from Sigma-Aldrich.
-
bioRxiv - Cancer Biology 2022Quote: ... Pre-equilibrated Protein G conjugated agarose beads (Roche) were added for 1 hour. ...
-
bioRxiv - Biochemistry 2022Quote: ... and T4 Gene 32 Protein (Gp32; Roche 10972983001) were obtained from commercial ven-dors ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were transferred onto Polyvinylidenfluorid (PVDF) membranes (Roche), blocked with 5% dry milk or 5% bovine serum albumin for 1 hour and incubated with primary antibodies overnight at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein-G agarose beads were manufactured by Roche. All other reagents were from Sigma-Aldrich.
-
bioRxiv - Cell Biology 2023Quote: ... The protein was digested with AspN protease (Roche) at 30°C for 16 hr ...
-
bioRxiv - Plant Biology 2023Quote: ... 50 ul of Protein A-agarose beads (Roche) was then added to the extract before overnight incubation ...
-
bioRxiv - Neuroscience 2021Quote: ... or precleared for 1 hr using 30 μl dry volume of a 1:1 mixture of protein-A and protein-G agarose (Roche Diagnostics). Solubilized membranes (3 mg of total membrane protein ...
-
bioRxiv - Neuroscience 2019Quote: Total proteins from mammalian cells were extracted from cells by resuspension and homogenization in RIPA buffer containing protein inhibitors (Complete, Roche Diagnostics) and phosphatase inhibitors (Phospho-STOP ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Glycogen assays (Pointe Scientific G7521-500, Roche 10102857001, Thermo Sci J16445-06), triglyceride assays (Pointe Scientific T7532-120 ...
-
bioRxiv - Cancer Biology 2020Quote: Cell viability was evaluated using the colorimetric WST-1 assay (Roche Diagnostics). After a 4-h incubation period with WST-1 reagent the absorbance was measured at 450 nm/ 600 nm using a microplate reader (ELISA-Reader Zenyth 200st ...
-
bioRxiv - Cancer Biology 2020Quote: ... Q-PCR was performed with SYBR green-based gene expression assays (Roche). Primer sequences are available on request.
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Centre (Roche), compatible with UPLs 157 (ActB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... And then qPCR assays were performed on the LightCycler 480 II (Roche) in 10μL reaction volume containing 6μL of SYBR green Master mix (Fisher Scientific A25918) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was measured by WST-1 assay following manufacture’s protocol (Roche). The IC50 and CC50 were calculated using a four-parameter logistic regression model from the GraphPad Prism 5 software (GraphPad Software Inc.).
-
bioRxiv - Bioengineering 2021Quote: Primers were designed using the Universal Probe Library Assay Design Center (Roche) and checked for specificity against the Physcomitrella transcriptome in the Phytozome database (Goodstein et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The assay was followed according to the manufacturers protocol (Roche Applied Science).
-
bioRxiv - Cell Biology 2021Quote: ... Te assay was performed according to the instructions of the vendor (Roche). The population doubling time was computed as the ln(2)/slope of the proliferation growth curve using Prism software ...
-
bioRxiv - Biochemistry 2022Quote: ... TUNEL assay was carried out according to manufacturers instructions (Roche Diagnostics, IN). Primary antibodies were visualized with species-specific secondary antibodies conjugated to fluorescent probes ...
-
bioRxiv - Biophysics 2022Quote: ... Cytotoxicity was also performed at matched concentrations using the MTT assay (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Center (Roche). Quantitative PCR was carried out using a LightCycler 96 (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... All qPCR assays were carried out on a LightCycler 480 (Roche Diagnostics) using the LightCycler 480 software version 1.5.1.
-
bioRxiv - Microbiology 2023Quote: ... qPCR assays were performed with a Light Cycler 480 II instrument (Roche), using the Maxima TM SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Immunology 2023Quote: ... The qPCR assays were done with FastStart Essential DNA Green Master (Roche) with the primers are listed in supplementary methods.
-
bioRxiv - Cell Biology 2024Quote: ... WST-1 assays to measure cell proliferation rate (Roche Cat. No. 5015944001) were conducted using the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2019Quote: ... were incubated with specific antibodies overnight and then with 60 μl of slurry of Protein A- or Protein G-agarose beads (Roche, Mannheim, Germany) for 3 h ...
-
bioRxiv - Cell Biology 2019Quote: ... were incubated with specific antibodies overnight and then with 60 μL of a slurry of Protein A- or Protein G-agarose beads (Roche, Mannheim, Germany) for 3 h ...