Labshake search
Citations for Roche :
301 - 350 of 7116 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... the cDNA inserts of the plasmids were isolated and amplified by low-cycle (12x) PCR using a Kapa2G Robust Hotstart PCR kit (Roche, Ref #07961073001) according to specifications ...
-
bioRxiv - Microbiology 2022Quote: ... then guide sequences were amplified from gDNA and the plasmid pool by nested PCR using KAPA HIFI Hotstart PCR kit (Kapa Biosystems, KK2501), as previously described in (Young et al. ...
-
bioRxiv - Microbiology 2023Quote: ... a 710 bp region was amplified by PCR using previously described primers (45) and the KAPA HiFi HotStart ReadyMix PCR Kit (Roche, Basel, Switzerland) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and the second-strand cDNA was synthesized using a KAPA Biosystems kit (Roche KAPA HiFi Hotstart PCR kit, KK2502) with VHgene-specific primers (No ...
-
bioRxiv - Microbiology 2020Quote: Quantification of the virus by qPCR was performed using the LightCycler 480 System (Roche, France) and specific primers designed in the non-structural gene NS1 (qAalDV2-F ...
-
bioRxiv - Plant Biology 2020Quote: ... and identified by morphological features.41 Polymerase chain reaction (PCR) products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany), and sequenced in both directions by Macrogen Inc ...
-
bioRxiv - Bioengineering 2021Quote: ... the quantitative real-time PCR (qRT-PCR) reactions were carried out using the KAPA SYBR FAST qPCR kit from Kapa Biosystems (MA, USA) with sfGFP-specific primer sets (Supplementary Table 4) ...
-
bioRxiv - Plant Biology 2021Quote: ... Digoxigenin-11-dUTP (DIG) labeled DNA probes were generated using via PCR labelling using PCR DIG Probe Synthesis kit (Roche, catalogue no. 11636090910). 10 ng of purified plasmid DNA containing full length GFP DNA was used as PCR template and amplified with GFP forward (TCAAGGACGACGGGAACTACAAG ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions were performed using 50 ng of metagenomic DNA per sample using the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Wilmington, USA). The individual PCR reactions were performed in 20 µL final volume and containing 4 µL of 5X Kapa HiFi Buffer ...
-
bioRxiv - Molecular Biology 2024Quote: DNA was extracted using a standard phenol:chloroform:isoamyl alcohol protocol (see Supplementary Methods for details on DNA extraction) from the sperm pools and prepared using a PCR-free library preparation kit (KAPA HyperPrep kit; Roche) for a standard insert size (400-500 bp)(see Supplementary Methods for details).
-
Optimized immunoglobulin knock-ins using Cas9 reveal peritoneal B cell lineage relationships in vivobioRxiv - Immunology 2021Quote: ... Custom DIG-labeled probes were generated using PCR DIG Probe Synthesis Kit (Roche #11636090910) and blots were hybridized for 16 hours at 48°C with a final concentration of 25ng/ml probe in 10ml DIG EasyHyb buffer rolling in hybridization tubes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each PCR product was ligated into Eam1105I-digested pJC53.2 vector (Quick Ligation Kit, Roche) for use in ISH and RNAi experiments (Collins et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and libraries were quantified by Q-PCR using the Kapa Library Quantification Kit (Roche). RNA-seq experiments were performed on an Illumina HiSeq3000 using a paired-end read length of 2×150 pb.
-
bioRxiv - Molecular Biology 2021Quote: ... QHR-4C libraries were purified by the High-Pure PCR Product Purification kit (Roche).
-
bioRxiv - Zoology 2020Quote: A first strand cDNA Synthesis Kit for rt-PCR (Roche Diagnostics GmbH, Mannheim, Germany) was used for first-strand cDNA synthesis of the RNA pooled from different developmental stages of Spadella cephaloptera ...
-
bioRxiv - Neuroscience 2020Quote: ... libraries were quantitated with real-time PCR using the KAPA Library Quantification Kit (Roche) per manufacturer’s instructions to determine final library nanomolarity ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was performed with the SYBR Green I Master kit (Roche Applied Science) in a LightCycler 480 ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative real-time PCR was performed using the KAPA SYBR Fast kit (KAPA biosystems) on a Rotor-Gene 6000 thermocycler (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes were prepared using the PCR DIG Probe Synthesis Kit (Roche, Basel, Switzerland, 11636090910).
-
bioRxiv - Molecular Biology 2022Quote: ... Probes were prepared using a PCR DIG Probe Synthesis Kit (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was isolated using the High Pure PCR Template Preparation Kit (Roche, 11796828001) and the PCR performed using the ALLin Red Taq MasterMix (highQu ...
-
bioRxiv - Neuroscience 2020Quote: DIG-labeled DNA probes were synthesized using PCR DIG Probe Synthesis Kit (Roche #11636090910). Primers were designed to target either external (676 bp ...
-
bioRxiv - Cell Biology 2020Quote: ... and qRT-PCR reaction was performed with KAPA SYBR FAST qPCR kit (KAPA Biosystems). At least triplicate samples were assessed for each gene of interest ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was performed with a SYBR Green I Master Mix kit (Roche) and LightCycler® 480 system ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using the Kapa Library Amplification Kit (Kapa Biosystems, Massachusetts, USA) and BSA 400ng/μL ...
-
bioRxiv - Biochemistry 2020Quote: ... released DNA was purified from protein components (High pure PCR Product Purification Kit, Roche) and chromatin quality analysed using EtBr agarose gel electrophoresis (1.3 % Biozym ME Agarose ...
-
bioRxiv - Biochemistry 2020Quote: ... released DNA was purified from protein components (High pure PCR Product Purification Kit, Roche) and analysed using ethidium bromide (EtBr ...
-
bioRxiv - Biochemistry 2021Quote: ... and libraries were quantified by Q-PCR using the Kapa Library Quantification Kit (Roche). RNA-seq experiments were performed on an Illumina HiSeq3000 using a paired-end read length of 2x150 pb ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by a second purification with High Pure PCR Product Purification Kit (Roche, Germany). The TOPO TA cloning kit (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... and tibiotarsal joint using Roche High Pure PCR template preparation kit (Roche, Indianapolis, IN) as previously described [62,63,90] ...
-
bioRxiv - Microbiology 2021Quote: ... Concentration of the pool was monitored with quantitative PCR (KAPA Library Quantification Kit, Roche). Amplicon libraries were mixed with 5% PhiX and sequenced with four MiSeq reagent kits v2 500 cycles (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... DIG-labeled LINE DNA probe was prepared by PCR DIG Probe synthesis kit (Roche). Hybridization and autoradiography were performed according to the DIG Application Manual (Roche).
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted using a Tissue Lysis Buffer and PCR template preparation kit (Roche).
-
bioRxiv - Microbiology 2023Quote: ... We re-circularized linearized plasmid PCR products with a Rapid DNA Ligation Kit (Roche) and transformed plasmids into DH5α-competent cells (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR was performed using the LightCycler480 SYBRGreen I Master1 kit (Roche Life Science) and the CFX Connect Real-Time PCR Detection System (BioRad) ...
-
bioRxiv - Molecular Biology 2024Quote: Liver genomic DNA was isolated using the High Pure PCR Template Preparation Kit (Roche), followed by RNAse A treatment ...
-
bioRxiv - Genomics 2024Quote: ... adapter ligation and PCR amplification was performed using the Kapa Hyper Prep kit (Roche). Beads were resuspended in 60 µL of a cocktail containing 50 µL H2O ...
-
bioRxiv - Microbiology 2023Quote: ... All PCR reactions were performed by KAPA HiFi HotStart ReadyMix kit (Roche, Cat# KK2601) and subsequently assembled by yeast [Saccharomyces cerevisiae strain EBY100 (ATCC ...
-
bioRxiv - Plant Biology 2023Quote: ... The 840 bp HPT probe was synthesized by PCR DIG Probe Synthesis Kit (Roche) using primers HPT-DIG-F and HPT-DIG-R (table S1) ...
-
bioRxiv - Cell Biology 2023Quote: Real-time PCR was performed using the LightCycler 480 SYBR Green Master Kit (Roche). The sequences of the primers used are shown in Fig ...
-
bioRxiv - Immunology 2022Quote: ... Library molarity was measured via quantitative PCR with the KAPA Library Quantification Kit (Roche) on a BioRad CFX Connect thermal cycler ...
-
bioRxiv - Microbiology 2022Quote: ... The probes were then purified using a PCR clean up kit (Roche Applied Science). The oligonucleotides had been ordered with 5’ biotinylated ends allowing for subsequent complex detection ...
-
bioRxiv - Cell Biology 2022Quote: ... Using a two-step nested PCR with KAPA HiFi HotStart ReadyMixPCR Kit (Kapa Biosystems), sgRNA expression cassettes were amplified ...
-
bioRxiv - Genomics 2024Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Microbiology 2024Quote: ... the genomic DNA was extracted using the High Pure PCR Template Preparation Kit (Roche), transferred in PE479 strain by natural transformation and selected according to the antibiotic resistances ...
-
bioRxiv - Genomics 2024Quote: PCR free libraries were prepared using the Kapa Hyper Prep Kit (Roche, Basel, Switzerland). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the samples were amplified by PCR using the KAPA HiFi Kit (KAPA Biosystems) for a minimum of eight cycles ...
-
bioRxiv - Microbiology 2022Quote: Total genomic DNA was extracted from the bacterial pellet as described previously [28] using the PowerFood™ Microbial DNA Isolation kit (MoBio Laboratories Inc., Carlsbad, USA) and the High Pure PCR Template Preparation kit (Roche Diagnostics Ltd ...
-
bioRxiv - Genomics 2020Quote: ... Library quantification was performed using the Qubit dsDNA High Sensitivity kit and quantitative PCR with the KAPA Quantification kit (Roche #KK4854) on a QuantStudio 5 real-time PCR system.
-
bioRxiv - Microbiology 2020Quote: ... or the 5’-flanking region of Bcflp2 (amplified with Probe2For and Probe2Rev primers) using the PCR DIG Probe Synthesis Kit and the DIG Luminescent Detection Kit (Roche, Germany) following manufacturer’s instructions.