Labshake search
Citations for Roche :
301 - 350 of 431 citations for Human NID1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Pax6a digoxigenin (DIG) antisense RNA probes were generated from linearised plasmids using an RNA labelling and detection kit (Roche) (Scholpp and Brand ...
-
bioRxiv - Microbiology 2022Quote: ... 1.5 million S2 cells were transfected with 2 μg of plasmid using Xtreme-GENE HP DNA transfection reagent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and transfected with the indicated plasmid 48 to 72 hrs prior to imaging using X-Treme gene HP (Roche) transfectant reagent according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sense and antisense riboprobes were transcribed from linearized plasmids and labeled with digoxigenin (DIG RNA-labelling reagents, Roche Biochemicals). Primers used to amplify zebrafish nhsb were 5’ tgatctaccttttctcccatgccatt 3’ and 5’ tctcacacaccacagaggctcca 3’ ...
-
bioRxiv - Genetics 2020Quote: ... and one day later 2 micrograms of plasmid DNA was transfected into cells using Xtremegene HP transfection reagent (Roche) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... and 0.8 μg of a EF1α promoter-transfer plasmid with 9 μl X-tremeGENE 9 or HP (both Roche). Lentiviral supernatant was harvested after 20–30 h and filtered through a 0.45 μm cellulose acetate filter ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were cotransfected with 4 μg of Env-deficient HIV-1 proviral plasmid (Q23ΔEnvGFP) and 2 μg of HIV-1 Env clone of interest using Fugene 6 transfection reagent (Roche) following manufacturer’s protocol ...
-
bioRxiv - Physiology 2020Quote: ... Cells were plated on six-well culture plates at 50% confluency and then transfected with 1 μg/well of the expression plasmid (pCDNA3.1-hTau441) using X-tremeGENE9 DNA transfection reagent (Roche). Cells were transferred to a 10-cm dish containing 300 μg/ml gentamycin-disulfate (G418 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... was introduced by site directed mutagenesis on C-terminal SNAP-tagged H3.1 (HIST1H3C coding sequence cloned in pSNAPm) and H3.3 (H3F3B coding sequence cloned in pSNAPm) encoding plasmids with a PCR master kit (Roche) and the primers indicated in Supplementary table 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmid minigenes were transfected 24 h after cell seeding using X-tremeGENE 9 DNA Transfection Reagent (Roche; Mannheim, Germany). HepG2 ...
-
bioRxiv - Bioengineering 2023Quote: ... The plasmid backbones and DNA fragments were amplified using the KAPA HiFi HotStart PCR kit (Kapa Biosystems, Boston, USA) and the primers described in Table S3 ...
-
bioRxiv - Neuroscience 2024Quote: ... The template plasmid was diluted to 5×107 copies/µL with nuclease-free water plus yeast RNA (Roche, 10109223001), and this solution was further diluted to 2.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... PBMC were seeded at 1 × 106 cells/mL in erythroid differentiation-promoting medium based on StemSpan™ Serum-Free Expansion Medium (SFEM) supplemented with human recombinant EPO (2 U/ml, Roche), human recombinant stem cell factor (25 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... The normalization of DNA amount was performed by quantifying albumin gene copies with qPCR using human genomic DNA (20 ng/µl) standard (Roche, #11691112001) as we previously described16.
-
bioRxiv - Microbiology 2019Quote: ... while all other specific primers were designed to be compatible with the Human Universal Probe Library set (90 probes, octamer, Roche Diagnostics) (Supplementary Table 9 ...
-
bioRxiv - Immunology 2019Quote: ... the wells were washed five times and incubated with 100 µl/well goat anti-human IgG conjugated with alkaline phosphatase (Roche Diagnostics) diluted 1 in 5,000 for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Cell Biology 2021Quote: ... adapter-ligated libraries were prepared with the KAPA Hyper Prep Kit and sequencing libraries were constructed using SeqCap EZ Human Exome Library v3.0 (Roche, Basel, Switzerland). Cluster generation was performed with the HiSeq PE Cluster Kit v4 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... then incubated for 30 min in Ringer solution before plating on fibronectin-coated glass coverslips (human plasma fibronectin at 10 µg/ml, Roche 10838039001).
-
bioRxiv - Microbiology 2021Quote: ... and washed once in cell lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) prior to processing lysates ...
-
bioRxiv - Microbiology 2021Quote: ... falciparum 3D7 or HEK 293F cells were suspended in 1× pellet volume of lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Resuspended parasites were then transferred to a prechilled nitrogen cavitation chamber (Parr Instrument Company ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human samples were analyzed using a combination of gene-specific primers and Universal Probe Library (UPL) hydrolysis probes (Roche Life Science). Threshold cycle (Ct ...
-
bioRxiv - Neuroscience 2020Quote: Total proteins from mouse cerebella or human cerebellar cortex were obtained by lysis in RIPA buffer containing protease inhibitors (Complete, Roche Diagnostics), followed by sonication and centrifugation using an established protocol in the laboratory31 ...
-
bioRxiv - Neuroscience 2023Quote: ... prior to transfection with 2 μg pcDNA3.1 encoding N-terminally HA-tagged human 1N3R tau or 1N4R tau (14) using X-tremeGENE 9 (Roche Life Sciences), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the T cells were activated in X-VIVO 15 containing 150 U/mL of human IL-2 (#Ro 23-6019, Roche, Switzerland), 10 ng/mL of recombinant IL-7 (#200-07 ...
-
bioRxiv - Cell Biology 2020Quote: hESC H9 cell line was transfected with 2ug of pB-CAG-Dest-pA-pgk-bsd-CENP-A-SNAP plus 2ug of pBASE plasmid (harbouring the piggybac transposase, kind gift from José Silva) using FuGeneHD (Roche), in a ratio of DNA:FuGene of 1:3 ...
-
bioRxiv - Cell Biology 2019Quote: ... Riboprobe synthesis for WISH was carried out with the linearized plasmid using digoxigenin (DIG) RNA labelling mix and T7 RNA polymerase (Roche) according to manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... 1.0 × 106 THP-1 cells were transfected with mixture of two sgRNAs-expressing plasmids (0.5 µg each) using X-tremeGENE™ 9 DNA Transfection Reagent (6365779001, Roche) according to manufacturer’s manual ...
-
bioRxiv - Developmental Biology 2021Quote: ... Digxigenin (DIG)-labeled sense and antisense probes were performed from the linearized pGEM-T-easy plasmids using the DIG RNA Labeling Kit (Roche).
-
bioRxiv - Developmental Biology 2020Quote: ... gbx1 and pax6a digoxigenin and FITC antisense probes were generated from linearized plasmids using an RNA labelling and detection kit (Roche)87 ...
-
bioRxiv - Plant Biology 2022Quote: ... The ELVd probe was obtained via in vitro transcription of a linearized plasmid for 1 h at 37°C with 20 U of T3 bacteriophage RNA polymerase (Roche) in 40 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2020Quote: ... were generated by transfection of 3×FLAG-tagged LRRK2 (WT) plasmid followed by pharmacological selection using an antibiotic G-418 (Roche). Transfection of plasmids and siRNA was performed using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... thermophila intron were obtained by in vitro transcription of the corresponding linearized plasmids with 20 U of T3 bacteriophage RNA polymerase (Roche) in 20-μl reactions containing 40 mM Tris-HCl ...
-
bioRxiv - Developmental Biology 2019Quote: ... Antisense DIG-labelled eiger RNA probe was prepared from XhoI-linearized pBSK-eiger plasmid using T3 RNA polymerase (DIG RNA Labeling Kit, Roche) and detected with the DIG Nucleic Acid Detection Kit (Roche) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the next day a total of 1 μg per well of a 1:1 mix of X22B and X22C CRISPR plasmids (either pX459 or pX462) was transfected by use of X-tremeGENE HP DNA transfection reagent (Roche). The next day ...
-
bioRxiv - Developmental Biology 2019Quote: ... Both sense and anti-sense RNA probes were synthesized from restriction enzyme linearized plasmids transcribed with T7 or SP6 polymerase in the presence of RNA DIG labelling mix (Roche). Newly synthesized probes were purified using mini QuickSpin columns according to the manufacturer’s protocol (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... the cells became 70-80% confluent and were transfected with the corresponding plasmids using the transfection reagent FuGENE 6 (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The 32P-radiolabeled probe was generated from a plasmid containing the entire HPV16 genome by radiolabeling using a Random Prime labeling kit (Roche).
-
bioRxiv - Bioengineering 2020Quote: ... The corresponding fragments were inserted in miRVec expression plasmid (restricted with the same enzymes) by ligation with T4 ligase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were first infected with plasmids bearing the hygromycin selection cassette followed by selection with 0.25 mg/ml hygromycin (Roche, 10843555001) for one week ...
-
bioRxiv - Molecular Biology 2021Quote: ... in 48-well plates and transfected at 50-60% confluence with a total of 100 ng Dual-pMIR-report plasmids using X-tremeGENE 9 DNA Transfection Reagent (Roche), followed by transfection with mimics (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: Aag2 cells were transfected with a plasmid expressing 3×flag tagged Zuc using X-tremeGENE HP DNA Transfection Reagent (Roche), and fixed 48 hours after transfection ...
-
bioRxiv - Molecular Biology 2021Quote: A 3×flag tagged Zuc expression plasmid was transfected into Aag2 cells using X-tremeGENE HP DNA Transfection Reagent (Roche). Cells were lysed and lysates incubated with M2-Flag beads (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... high specific-activity RNA probes were produced from a linearized plasmid (HindIII) and labeled using the Fluorescein RNA Labeling Mix (Roche), following manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: Lentivirus was produced in HEK293T cells using helper plasmids (VSVG and psPAX2) with X-tremeGENE 9 DNA Transfection Reagent (Roche). Target cell lines were infected with the virus and 10 μg/ml polybrene ...
-
bioRxiv - Bioengineering 2021Quote: Biotin-labeled dsDNA template was first amplified from the plasmid encoding the template design with biotin-labeled primers using KAPA HiFi HotStart ReadyMix PCR Kit (Roche) for 35 cycles (98°C for 20 s ...
-
bioRxiv - Genetics 2019Quote: ... 1 ug purified digested plasmid was used as template for SP6 or T7 transcription using the DIG-RNA labeling kit (Roche). Following probe transcription ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were transfected with 1 μg Kras or control expression plasmid and 1 μg of viral packaging plasmids (250 ng pMD2.G and 750 ng psPAX2) using 6 μl of X-tremeGENE 9 transfection reagent (Roche). After 24 hours of transfection ...