Labshake search
Citations for Roche :
301 - 350 of 8134 citations for 6 Methyl 2 3 4 9 tetrahydro 1H carbazol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection reagent (Roche), with 1.2 µl X-tremeGENE reagent per 500 µg DNA reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... using X-treme GENE 9 DNA transfection reagent (Roche, XTG9-RO) to produce the lentiviral particles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Bioengineering 2021Quote: Second-round library PCR (Fig. 1H) was performed using Kapa HiFi Hotstart Readymix (KK2602, KAPA Biosystems) in 100 μl reaction volume with 10 μl of 2 nM first-round PCR product as a template and forward (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CT*T *C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 µg of 330-BFP-CYP3A4-enhancer-R-sgRNA were transfected with X-tremeGENE 9 DNA transfection reagent (Roche 6365809001). After 3-5 days ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was measured 6 days post transfection using WST-1 reagent (Roche). Cells were incubated with 10 μl of WST-1 per 100 μl of media for 1 hour and absorbance was read at 450 and 630 nm ...
-
bioRxiv - Genomics 2023Quote: ... 6 μL of Ligation-1 mix (3.75 U T4 DNA ligase (Roche, 10799009001), 33.3 mM DTT (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Pools of 6 ganglia were homogenized in 1 ml TriPure isolation reagent (Roche) using lysing matrix D on a FastPrep24 instrument (3 cycles of 40 seconds at 6 m/s) ...
-
bioRxiv - Microbiology 2023Quote: ... Pools of 6 ganglia were homogenized in 1 ml TriPure isolation reagent (Roche) using lysing matrix D on a FastPrep24 instrument (3 cycles of 40 seconds at 6 m/s) ...
-
bioRxiv - Microbiology 2021Quote: ... employing 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) and nitro blue tetrazolium (NBT) as substrates (RocheR, Roche Applied Sciences ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were stained with NBT (Nitroblue tetrazolium) and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland) in developing solution at 37°C for 2 hrs ...
-
bioRxiv - Neuroscience 2020Quote: ... the alkaline phosphatase activity was detected by using nitroblue tetrazolium chloride (337.5μg/ml) and 5-bromo-4-chloro-3-indolyl phosphate (175μg/ml) (Roche Diagnostics). Sections were mounted in Mowiol.
-
bioRxiv - Developmental Biology 2019Quote: ... and stained with standard Nitro Blue Tetrazolium (NBT) and 5-Bromo-4-chloro-3-indolyl phosphate (BCIP) (Roche) ISH protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Colorimetric signals were generated using a development solution containing 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were incubated at 37°C for 3-4 h before adding DNase I (0.1 U/µl) (Roche) and incubating for another 30 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... levodopa (Madopar®, Roche, Levodopa/carbidopa, ratio 4:1) was administered twice daily for 4-5 months at an individually-tailored dose designed to produce a full reversal of the parkinsonian condition (p.o ...
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... One milligram of DNase I (Roche), 1 mg of RNase A (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with one cOmplete tablet (Roche) and 1mM PMSF ...
-
bioRxiv - Biochemistry 2023Quote: ... one complete protease inhibitor tablet (Roche), 1 mg/mL final concentration of Na-heparin ...
-
bioRxiv - Biochemistry 2021Quote: ... 25 mM imidazole) supplemented with 1 mM PMSF and one tablet of complete EDTA free (Roche). After sonication at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM DTT and complete EDTA-free protease inhibitor tablets (one tablet/50 mL buffer) (Roche)) ...
-
bioRxiv - Biophysics 2024Quote: ... 5% glycerol) per 1 L of cells with one EDTA-free protease inhibitor cocktail tablet (Roche). Cells were lysed using a Misonix Sonicator 3000 (110 W for 2 min total ON-time ...
-
bioRxiv - Microbiology 2020Quote: We obtained OP and NP samples from one hospitalised COVID-19 patient who had tested virus-positive three weeks earlier (cobas® SARS-CoV-2 test, Roche diagnostics), from three individuals who had previously tested SARS-CoV-2 positive ...
-
bioRxiv - Cell Biology 2019Quote: ... pH 7.6, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, and 1 x protease inhibitors [Roche]) was added per well ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA transfection was performed using X-tremeGENETM 9 DNA transfection reagent (Roche) in OptiMEM media according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... The transfection was performed using X-tremeGENE 9 DNA transfection reagent (Roche) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral helpers and constructs were transfected using X-tremeGENE 9™ (Roche) according to the manufacturer’s instructions at a 1:3 ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche, 6365787001), and 24 h later 5000 GFP+ cells were sorted into a well of six-well plate using mTeSR1 medium supplemented with 10 µM Y-27632 ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed using the X-tremeGENE 9 Transfection Reagent kit (Roche) to introduce 1-2 μg of plasmid DNA as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmids were transfected using X-tremeGENE 9 DNA transfection reagent (Roche, 6365787001) following the manufacturer’s protocol (1 μg plasmid ...
-
bioRxiv - Physiology 2022Quote: ... 150 ng of each plasmid were transfected with X-tremeGENE 9 (Roche) in C2C12 myoblasts immediately after trypsinization (47) ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE1 cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2024Quote: ... two steps of transfections were performed: DNA using XtremeGENE™ 9 (Roche) followed by siRNA (4392420-s30722 ...
-
bioRxiv - Genetics 2024Quote: ... and viral envelope vector gag-pol using XtremeGene 9 transfection reagent (Roche). Collection of viral particles and transduction was performed as described for lentiviral particles ...
-
bioRxiv - Immunology 2024Quote: ... catalog number 2708) using the X-tremeGENE 9 DNA Transfection Reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche Diagnostics). Full-length human TREK-1(TREK-1 FL ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were arrested at metaphase by incubating with colcemid (N-methyl-N-deacetyl-colchicine, Roche, 10295892001) for the last 14 hours before harvesting the cells ...
-
bioRxiv - Neuroscience 2022Quote: ... and then reacted with 0.375 mg/mL nitroblue tetrazolium and 0.188 mg/mL 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP; Roche Diagnostics) for 27—42 h.