Labshake search
Citations for Roche :
301 - 350 of 6057 citations for 6 AMINOMETHYL INDOLE 1 CARBOXYLIC ACID TERT BUTYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The nucleic acid pellet was resuspended TE buffer and treated with 0.05 µg/µL RNase (Roche Cat# 11119915001) for >15 hr at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... they were purified in large volume columns using the High Pure Viral Nucleic Acid Large Volume Kit (Roche) with 2.5 mL of PB buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with siRNAs or plasmid DNAs using Dharmafect 4 (Dharmacon) or Fugene 6 (Roche Applied Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded in 10 cm tissue-culture treated dishes and transfected with FuGENE 6® reagent (Roche) for 24 hr ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Biochemistry 2022Quote: (His)6-GST-SNX15 MIT was bound to cOmplete His-Tag purification beads (5 mL, Roche, Germany, 2h) and washed with 2 L wash buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were incubated with 4′,6-diamidino-2-phenylindole (DAPI; F. Hoffmann-La Roche, Natley, NJ, USA) and appropriate donkey anti-mouse/rabbit/rat/chicken secondary antibodies conjugated to Alexa Fluor 488 ...
-
bioRxiv - Neuroscience 2022Quote: ... hDAT and Stx1 constructs were transiently cotransfected into these cells (hDAT cells) using Fugene-6 (Roche Molecular Biochemicals) per the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The mini-genes in the pSPL3b vector were transiently transfected using 6µl of FuGENE 6 Transfection Reagent (Roche) with 2 µg of vector ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... five pupae were homogenized in 100uL of homogenization buffer (125 mM Tris pH 6.8, 6% SDS, 2.5X Roche cOmplete protease inhibitor cocktail ...
-
bioRxiv - Neuroscience 2023Quote: ... Vectors were co-transfected with packaging-defective helper plasmids into 293T cells using Fugene 6 transfection reagent (Roche). Fibroblasts were plated at a density of 50,000 cells/well on 0.1% gelatin-coated 6-well plates and infected three times with a viral cocktail containing vectors expressing OCT4:SOX2:KLF4:cMYC in a 2:1:1:1 ratio in the presence of 6 µg/ml protamine sulfate (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant containing chromatin fragments was then treated with 6-10 µg/g cells DNase-free RNase (Roche) at 37°C for 30 minutes and subsequently cleared by centrifugation at 30,000 rcf for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Both were fragmented at 94°C for 6 min and ligated with KAPA Unique Dual-Indexed adaptors (Roche). Library quality was checked on an AATI (now Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... an additional 6-cycle PCR was carried out with the HiFi HotStart Ready Mix (Kapa Biosystems, Wilmington, MA) and primers that preserve the DNA sequence ...
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Next embryos were washed in blocking solution (100mM maleic acid, 150 mM NaCl pH 7.5, 2% blocking reagent (Roche)) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Physiology 2021Quote: ... Trypsin activity was then inhibited by adding to the homogenate bovine serum albumin (BSA) fatty acid free (0.25 mg/mL) and protease inhibitor cocktail (PIC, Roche).
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... in complementary deoxyribonucleic acid (cDNA) from 10 ng total RNA in 10 μl reactions with 2× Master Mix (Roche) in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... The cell pellet collected from 6 L growth was resuspended in 20 mM HEPES (pH 7.8) containing protease inhibitor cocktail (Roche) and DNase I (Sigma) ...
-
bioRxiv - Genomics 2020Quote: ... primers listed in Supplementary Table 6 were used to perform two consecutive PCR reactions with KAPA HiFi polymerase (Roche). Starting from 100 ng of library plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were plated onto collagen-coated plates and transfected at 60-80% confluency using FuGENE 6 (Roche, Indianapolis, IN) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and packaging plasmids PEx-QV and pMD-G were co-transfected into HEK 293T cells using Fugene 6 (Roche). After 4 days ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Cell Biology 2022Quote: ... The protein lysate was electrophoresed into 6-10% SDS-PAGE gels and transferred to a PVDF membrane (Roche, 03010040001). After blocking with 5% BSA ...
-
bioRxiv - Microbiology 2021Quote: Virus stocks were generated by transfection of 293T cells with each plasmid clone of HSIV-vif using Fugene 6 or X-tremeGENE 9 DNA transfection reagent according to the manufacturer’s protocol (Roche). Infectious titers were determined by limiting dilution infection analysis using TZM-bl indicator cells and the amount of virus in supernatants was measured by HIV-1 p24gag antigen ELISA (Advanced Bioscience Laboratories).
-
bioRxiv - Immunology 2019Quote: ... 4μg of Env DNA containing CMV promoter was combined with 4μg of SG3Δenv backbone and FuGene 6 transfection reagent (Roche Diagnostics) was added as per manufacturer’s instructions ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... Fluorescent counterstaining of cell nuclei was carried out in a PBS solution with 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals ...
-
bioRxiv - Physiology 2020Quote: Islets were isolated from male C57BL/6 mice at 2 to 4 month of age using Collagenase P (Roche Diagnostics ...
-
bioRxiv - Genetics 2020Quote: ... 400ng of total RNA (RIN >6) was used to generate polyA-selected libraries with Kapa mRNA HyperPrep kits (Roche) with indexed adaptors ...
-
bioRxiv - Microbiology 2023Quote: 10-25ml of bacterial cultures were pelleted and resuspended in extraction buffer (50mM Tris-HCl pH 7.5, 5mM EDTA, and 6% SDS) with protease inhibitor cocktail (Roche; 1mg/ml Aprotinin ...
-
bioRxiv - Systems Biology 2023Quote: Glucose concentrations from the chemostat samples were determined enzymatically with a solution of hexokinase/glucose-6-phosphate dehydrogenase (Roche) in Pipes buffer at pH 7 ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 μg pAcBAC3 plasmid was used to transfect RAW 264.7 cells by mixing the DNA with 6 μg X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: RNA extraction from A549 cells grown in 6-well plates was done using High Pure RNA isolation kit (Roche). Transcriptor First strand kit (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... αSMA-tk;RFP mice and C57BL/6 mice received intraperitoneal (i.p.) injections with 12.5 mg/kg of body weight of ganciclovir (GCV, Cymevene®, Roche) every 48h ...
-
bioRxiv - Cell Biology 2024Quote: ... After washes, the cells were stained with the DNA stain DAPI (4, 6 diamidino-2-phenylindole dihydrochloride) (Roche, #1023627001) and mounded with Prolong gold anti-fade mound media (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... L6 cells and cardiomyocytes by incubating them in their respective media containing 2% (w/v) fatty acid-free bovine serum albumin (FAF-BSA; Roche) and 0.4 mM sodium palmitate (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Biochemistry 2019Quote: ... washed in 15 ml of sucrose-MOPS buffer (250 mM sucrose, 20 mM 3-morpholinopropanesulfonic acid, pH 7.4, supplemented with complete EDTA-free protease inhibitors, Roche, Switzerland) and resuspended in 4 ml of sucrose-MOPS buffer ...
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...