Labshake search
Citations for Roche :
301 - 350 of 6669 citations for 1 4 Bromo 3 methylphenyl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and amplified 6 times (Sets 1 and 2) or 8 times (Set 3) with a KAPA Library Amplification Kit (KAPA Biosystems). The amplification products were cleaned using Agencourt Ampure XP reagent or KAPA Pure Beads ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 tetrazolium]-bis(4-methoxy-6-nitro)-benzene sulfonic acid hydrate (XTT)-based colorimetric assay (Roche) according to manufacturer-recommended protocols ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mg/mL DNAase (Roche, 04716728001). The cells were resuspended by mechanical agitation through Pasteur pipettes flamed with decreasing diameters ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2024Quote: ... knee cartilage was harvested from postnatal day 3-5 mice and treated with 3 mg/ml collagenase D (11088866001, Roche) in DMEM (10569010 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... bovine serum albumin in TBS-T and incubated for 16 h at 4°C: mouse anti-GFP (1:1000) (Roche), sheep anti-CK1α (1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated overnight at 4°C with anti-Digoxigenin antibody coupled to alkaline phosphatase (Roche, 11207733910, used at 1/4000). The last day ...
-
bioRxiv - Microbiology 2022Quote: Total RNA from 4 replicates of BCBL-1 WT clone B4 and 57KO clone #6 cells were isolated by TriPure Reagent (Roche) 24 h after induction with VA ...
-
bioRxiv - Molecular Biology 2021Quote: T98G cell pellets were fixed by dropwise addition of cold 70% ethanol and their DNA was stained with 4’,6-diamino-2-phenylindole (1 μg/ml, Roche), 0.1% Triton X-100 in phosphate-buffered saline (PBS) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the soluble fraction was incubated for 1 h at 4°C with beads crosslinked to mouse anti-GFP antibody (Roche). Resulting Immunoprecipitates were washed three times with lysis buffer and protein eluted with RapiGest surfactant (Waters ...
-
bioRxiv - Genomics 2020Quote: ... Real-time quantitative PCR reactions were set up in triplicate with 2 μL of cDNA (1:4 dilution) per reaction using the FastStart Universal SYBR Green Master mix (Rox) (Roche) and run on a 7500 Real-Time PCR System (Applied Biosystems) ...
-
Elevated Hoxb5b expands vagal neural crest pool and blocks enteric neuronal development in zebrafishbioRxiv - Developmental Biology 2021Quote: ... Probed embryos were blocked for 1-2 hours at ambient temperature in 5% Goat sera in PBST before detection overnight (∼16 hours) at 4°C using an anti-Digoxigenin-Fab fragments conjugated to Alkaline Phosphatase enzymes (1:1000 dilution, Roche) in 5% Goat Sera in PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 200 mM NaCl, 1% NP-40, 2 mM MgCl2, 10% glycerol, NaF +Na3VO4, complete mini tablets without EDTA, Roche). Lysates were incubated on ice for 15 minutes and centrifuged at 17,000xg at 4°C for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... the sections were incubated overnight at 4 °C in digoxigenin antibodies conjugated to horseradish peroxidase (anti-digoxigenin-POD; Fab fragment; 1:100; Roche), rinsed in TBS (0.1 M Tris-HCl with 0.9% NaCl ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated overnight at +4 °C with the antibody anti-digoxigenin-AP Fab fragment (#11093274910, Roche, 1:1000) diluted in blocking solution in a humidity chamber ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at 4°C with primary antibody for rat anti-HA (1:200; 12013819001, RRID:AB_390917, Roche, Basel, Switzerland), rabbit anti-GFP (1:200 ...
-
bioRxiv - Immunology 2020Quote: ... Bacterial pellets obtained by centrifugation at 13,500g for 10 min at 4°C were resuspended in 1 ml of PBS containing protease inhibitors (cOmplete Mini, Roche; 1 tablet per 10 ml of PBS following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were incubated overnight at 4°C with an anti-DIG-AP antibody (Roche, diluted 1:2000 in blocking solution). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked with blocking solution for 1 hour and finally incubated overnight at 4°C with anti-Fluorescein-POD antibody (Roche) diluted 1:500 in blocking solution ...
-
bioRxiv - Cell Biology 2022Quote: ... isolated from each cell line was collected by centrifugation (30 000 x g, 4°C, 10 min) and resuspend in 1 x PBS supplemented with protease inhibitors (Roche) to protein concentration 1.5 mg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sonicated samples were centrifuged and the supernatant (soluble fraction) was incubated for 1 h at 4°C with beads crosslinked to anti-GFP antibody (11814460001; Roche) or to M2 anti-FLAG antibody (F1804 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in PBS for 30 min and incubated overnight at 4°C with 1:1,500 anti-HA high affinity (Roche, 3F10). After three PBS washes ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed once with PBS and resuspend with Tris-HCl containing 4 mM EDTA and 1× complete protease inhibitor cocktail (Roche). Dounce homogenizer is used to fractionate the cell membranes and then 3 min 600 g centrifugation was used to obtain Post-Nuclear Supernatants (PNS) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed 2 × 5 min at 4 °C with cold 1 × PBS containing protease inhibitor cocktail (Roche, #4693132001), snap frozen and stored at −80°C until awaiting further processing ...
-
bioRxiv - Bioengineering 2023Quote: ... The primary antibodies and respective concentrations used in this study are the following: 4’,6-diamidino-2-phenylindole (DAPI) (1:500, Roche), anti-Ki67 (1:100 ...
-
bioRxiv - Genomics 2023Quote: One hundred mg of 14-day-old seedlings were ground and nuclei were isolated with 4°C Buffer (0,25M Sucrose, 10mM Tris-HCl, 10mM MgCL2, 1% Triton, 5mM ß- mercaptoethanol) containing proteinase inhibitor cocktail (Roche) and filtered in 63 µm ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...