Labshake search
Citations for Roche :
3401 - 3450 of 9201 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... then the beads were washed 3 × with washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 100 μM CaCl2 ...
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mL of Tris (pH = 8.5) and 3 tablets each of the protease/phosphatase inhibitors PhosStop and Complete Mini (Roche). Tissues were then lysed in Precellys Homogenizer Bertin (program 6 x 20s pulse ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Cancer Biology 2024Quote: ... nuclei were isolated from 5 million cells with hypotonic buffer (20 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, protease inhibitors (Roche)) for 15 min on ice ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mM EDTA, 1% SDS, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride, and 1× Roche Protease Inhibitor Cocktail) and sonicated to reduce the average DNA fragment size to ∼500 bp ...
-
bioRxiv - Immunology 2021Quote: ... 5% Sarkosyl) and samples were treated with proteinase K (50μg/mL) and Ribonuclease A (Roche) for 30 minutes at 37°C to remove contaminating proteins and RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM EDTA at pH 8) containing protease inhibitors (cOmplete mini EDTA-free tablets, Roche) for 30 mins on ice ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 0.25 μM gene-specific primers and 5 μl LightCycler 480 SYBR Green I Master (Roche) on a Roche LightCycler 480 II real-time PCR System according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.2% IGEPAL and 5 mM EDTA) and supplemented with a protease inhibitor cocktail (Roche diagnostics). Samples were centrifuged at 2,350 g for 10 min at 4°C and the supernatant was collected ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM sodium pyrophosphate) containing 0.05% PMSF and EDTA-free Complete protease inhibitor cocktail (Roche). Equal volume of acid washed 0.45 mm glass beads (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 5% glycerol) containing 100 mM Phenylmethylsulphonylfluoride (PMSF) and EDTA-free Protease inhibitor cocktail tablets (Roche). Resuspended cells were first treated with 1 mg/ml Lysozyme to digest the cell wall and subsequently frozen at −80°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... consisting of MS1 with 300 mg/L carbenicillin and 5 mg/L hygromycin (Roche, Germany) (YFT1-CDS) ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR reactions were prepared using 5 μL of FastStart SYBR Green Master mix (Roche Diagnostics) with a final concentration of 1μM of each primer ...
-
bioRxiv - Immunology 2020Quote: ... membranes were blocked in 5% BSA (BSA Fraction V; Roche Life Sciences, Almere, The Netherlands) in TBS-T or 5% milk in TBS-T for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% milk and probed with 3F10-HRP anti-HA antibody (Roche) followed by imaging with ECL.
-
bioRxiv - Molecular Biology 2019Quote: ... 1.5 μl DNA Pol Mix (5 U/μl, Expand Long Template PCR System, Roche Diagnostics), 27.25 μl PCR HPLC Gradient Grade H2O and 1 μl template (primary WTA product) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 2ME [pH 7.5]) supplemented with protease and phosphatase inhibitors (Roche, Indianapolis, IN) for 20 minutes on ice ...
-
bioRxiv - Cell Biology 2019Quote: ... ATP 5 mM) supplemented with proteases and phosphatase inhibitors (cOmplete EDTA-free and PhosSTOP, Roche). Cells were homogenized in a ball homogenizer with 10 μm clearance ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 mM beta-mercaptoethanol (BME)) with protease inhibitors (cOmplete™ EDTA-free, Roche, Indianapolis, IN). Lysozyme (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... A 5% Triton X-100 solution with 1x protease inhibitors (Roche Complete Mini, EDTA free) was added 1:1 to a 50 μl worm pellet ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by PCR amplification with EcoRI-CEP131-5’ (ACCGAGAATTCCATGAAAGGCACCCGGGC) using KAPA HiFi DNA polymerase (Roche). The product was digested with EcoRI and BamHI and ligated into similarly digested pEGFP-C1 (Clontech) ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were then blocked in PBT 0.2% with 5% bovine serum albumin (Roche, Cat# 10735094001) before staining with primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2022Quote: ... 5 μL KAPA SYBR® FAST Master Mix (2X) Universal (Kapa Biosystems Inc., MA, USA), and 100 nM of gene-specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... and immunoprecipitated with 5 μg Mouse monoclonal anti-GFP antibody (clone 9E10, IgG, Roche, Switzerland). About 200∼300 bp of ChIP DNA and input DNA were recovered and dissolved in water for further qPCR analysis [82] ...
-
bioRxiv - Plant Biology 2022Quote: ... The 5’-end biotin probes were generated using a DIG Gel Shift Kit (Roche, China) (Supplemental Table S8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM EDTA pH 8.0) supplemented with protease inhibitors (cOmplete Protease Inhibitor Cocktail, Roche, 11697498001) and lysed by vortexing at 4 °C for 15 minutes.™ Cell debris was pelleted by spinning at 21000 RCF at 4 °C for 15 minutes and protein containing supernatant was taken ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5×106 K562 cells were resuspended in PBS with EDTA-free protease inhibitor cocktail (Roche) and lysed using a 27.5G needle ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM MgCl2 and 0.25 M sucrose) supplemented with a protease inhibitor cocktail tablet (Roche). Successively ...
-
bioRxiv - Physiology 2023Quote: ... Worms were homogenized in PBS containing 5% TritonX-100 and a protease inhibitor cocktail (Roche), and lipid was extracted using the TissueLyser II (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.2 μl (5 U/μl) FastStar Taq DNA Polymerase (Roche Diagnostics GmbH, Mannheim, Germany) in a total volume of 25 μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... fibronectin-coated (5 μg/cm2 coating the outer part of the membrane, Roche, cat#11080938001) inserts in 24-well plates (Corning-Falcon cat# 353097) ...
-
bioRxiv - Molecular Biology 2023Quote: ... plasmid DNA containing EEEb1 was labeled with cyanine-5-dUTP by Nick Translation Mix (Roche), while plasmid DNA harboring each of the other nine DNA families (EEEb2–EEEb10 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Media was aspirated and minced tissue was digested with ∼5 mg of Collagenase P (Roche) in 5 mL cold HBSS for 15-20 minutes ...
-
bioRxiv - Genetics 2024Quote: ... snRNA-seq 5’ libraries were balanced using a Kapa library quantification kit (Roche, Indianapolis, IN) and pooled to generate 150 base pair ...
-
bioRxiv - Neuroscience 2024Quote: Adenosine 5’-triphosphate (ATP) levels were assessed using an ATP Bioluminescence assay Kit (Sigma/Roche). Briefly ...
-
bioRxiv - Biophysics 2024Quote: ... 5% (v/v) Glycerol and EDTA-free protease inhibitor cocktail tablet/50 ml (Roche, UK)] ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL PCR grade water and 12.5 µL KAPA HiFi HotStart ReadyMix (Roche, Indianapolis, USA). Samples were normalized and pooled in equimolar amounts and the pools were sequenced on the Illumina MiSeq machine with the 2 x 300 bp V3 kit at the USEQ sequencing facility (Utrecht University ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µL PCR grade water and 12.5 µL KAPA HiFi HotStart ReadyMix (Roche, Indianapolis, USA). The PCR conditions were 98°C for 5 min ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were fixed with 4%PFA and 100 μl of Annexin-V-Alexa 568 labeling solution (Roche) and 50 μM Sytox Green dye (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 15 minutes with 4 μL of X-treme Gene HP DNA transfection reagent (Roche). Transfected cells were selected for by hygromycin resistance ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse/rabbit IgG overnight at 4°C and further with protein G-coupled agarose beads (ROCHE) for 1-2 h ...