Labshake search
Citations for Roche :
3301 - 3350 of 5471 citations for Rat Malonyl Coenzyme A Decarboxylase MLYCD ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... the membrane was blocked with blocking buffer and incubated with anti-DIG antibody (Roche detection kit), washed (maleic acid ...
-
bioRxiv - Genetics 2020Quote: ... pre and post capture multiplexing were performed using the SeqCap EZ Choice XL kit (Roche NimbleGen) and TruSeq index barcodes (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were quantified by qPCR using the KAPA quantification kit for Illumina platforms (KAPA Biosystems, Roche). Samples were pooled in equimolar fashion ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were quantified by qPCR using the KAPA quantification kit for Illumina platforms (KAPA Biosystems, Roche). Samples were pooled in equimolar fashion ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the genome capture was performed using the SeqCap EZ Hybridization and Wash Kit (Roche, Basel, Switzerland), SeqCap EZ Accessory Kit v2 (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: Apoptosis in kidneys was detected using the In Situ Cell Death Detection Kit (Sigma Aldrich/Roche). Briefly ...
-
bioRxiv - Physiology 2021Quote: ... and cDNA library construction were conducted using a stranded mRNA-Seq Kit (Kapa biosystems, KR0960 – v6.17). 50bp paired-end sequencing was performed on an Illumina NovaSeq 6000 and at least 35 M reads were obtained per sample ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were then equimolarly pooled and quantified by qPCR using the KAPA library quantification kit (Roche). Sequencing was carried out on the NovaSeq 6000 (Illumina) ...
-
bioRxiv - Neuroscience 2020Quote: ALS and FTD patients were screened for C9orf72 using the FastStart Taq DNA Polymerase Kit (Roche).
-
bioRxiv - Developmental Biology 2020Quote: Digoxigenin-labeled cRNA probes were prepared by in vitro transcription (DIG RNA labeling kit; Roche Diagnostics) from the following templates ...
-
bioRxiv - Genomics 2019Quote: ... 11-800ng of genomic DNA was used using the KAPA Hyper Prep Kit (Kapa Biosystems KK8504) with 7-12 cycles of PCR ...
-
bioRxiv - Microbiology 2022Quote: ... used a LightCycler® 480 High Resolution Melting Master (HRMM) kit (Roche; Cat. No. 04909631001, Roche Diagnostics Australia Pty ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing the gene-coding sequences via in vitro transcription using DIG RNA Labeling Kit (Roche, 11175025910). A short bleaching was used to remove the pigments from the fixed zebrafish embryos.
-
bioRxiv - Pathology 2021Quote: ... Cell apoptosis was examined utilizing a TUNEL (Terminal deoxynucleotidyl transferase dUTP nick end labeling) kit (Roche). In brief ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral RNA was reverse-transcribed to cDNA using a Transcriptor First Strand cDNA Synthesis kit (Roche Diagnostics BV ...
-
bioRxiv - Neuroscience 2021Quote: The Roche Optiview DAB IHC kit was used in a Ventana Benchmark Ultra (Roche, Basel Switzerland) immunostainer to immunohistochemically stain SARS-CoV-2 ...
-
bioRxiv - Developmental Biology 2020Quote: ... qPCR experiments were performed using the LightCycler® 480 SYBR Green I Master kit (Roche, 04707516001) on a LightCycler® 96 machine (Roche) ...
-
bioRxiv - Plant Biology 2022Quote: ... the libraries for RNA-sequencing (RNA-seq) were prepared by the KAPA mRNA HyperPrep Kit (Roche). The quality of each library was validated with a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... BACPAC Resources) were labelled with digoxigenin-dUTP or biotin-dUTP using a nick translation kit (Roche), denatured (95°C ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCRs were performed using KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems) on a LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Microbiology 2020Quote: EMSAs were performed as described previously using a DIG Gel Shift Kit (2nd Generation, Roche, USA) (19) ...
-
bioRxiv - Immunology 2021Quote: ... Cellular mRNA of cells not exposed to virus was isolated with an mRNA Capture kit (Roche) and cDNA was synthesized with a reverse-transcriptase kit (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing libraries were generated using the KAPA Stranded RNA-seq Kit with RiboErase (HMR) (Roche, 07962282001) according to the manufacturers protocol ...
-
bioRxiv - Immunology 2020Quote: ... viral RNA was isolated from plasma using a MagNA PureCompact Nucleic Acid Isolation kit (Roche Diagnostics). Real-time RT-PCR was performed using a QuantiTec Probe RT-PCR kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... Illumina sequencing libraries were constructed using the Kapa Stranded RNA-seq Kit with RiboErase (Kapa Biosystems) and 100 ng of total RNA ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR was conducted using a Kapa 2G Robust PCR kit (Kapa Biosystems, Woburn, MA, USA) in 25 µ L reactions containing ...
-
bioRxiv - Molecular Biology 2020Quote: ... The qPCR reaction was set up using the KAPA SYBR FAST ABI Prism kit (KAPA Biosystems) according to manufacturer’s instructions and run on a Quant Studio 3 System (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... Complementary DNA (cDNA) was synthesized using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). KIR transcripts were amplified specifically from cDNA using primer pairs described previously (Yawata et al ...
-
bioRxiv - Genomics 2021Quote: ... o libraries were prepared for sequencing using the Kapa stranded RNA-Seq kit with riboerase (Roche) according to the manufacturer’s instructions and sequenced 150bp paired end on Illumina HiSeq 2500 or Illumina HiSeq 4000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... assays were carried out using the in Situ Cell Death Detection Kit (11684795910; Roche, Basel, Switzerland) as previously described (Liu et al. ...
-
bioRxiv - Immunology 2021Quote: ... Adapters necessary for sequencing on the Illumina platform were introduced with the KAPA HyperPrep kit (Roche). Libraries were sequenced on Illumina MiSeq platform (2×150).
-
bioRxiv - Cell Biology 2021Quote: ... The barcoded libraries were purified and quantified using the Library Quantification Kit - Illumina/Universal (KAPA Biosystems) on a TaqMan 7500 RealTime PCR System ...
-
bioRxiv - Genomics 2021Quote: ... RNA-Seq libraries were prepared using KAPA RNA HyperPrep Kit with RiboErase (HMR) (Roche, California, USA) by 8 cycles of PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... The RNA-seq libraries were prepared with KAPA Stranded mRNA-Seq Illumina® Platforms Kit (Roche) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... Messenger RNA library construction was performed using the Kapa HyperPrep mRNA Stranded with Riboerase kit (Roche). Each indexed sample was pooled in equimolar amounts and sequenced on one lane of HiSeq4000 by Novogene.
-
bioRxiv - Microbiology 2021Quote: Sequencing libraries were constructed using the KAPA RNA HyperPrep kit following manufacturer’s protocol (Roche Sequencing Solutions). To enrich for SARS-CoV-2 sequence ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the cDNA library was constructed with the KAPA stranded RNA-seq kit (KAPA biosystems KK8400) according to manufacturer’s protocol with Illumina Truseq forked adapters ...
-
bioRxiv - Developmental Biology 2022Quote: ... The TUNEL cell death assay was performed using the In Situ Cell Death Detection Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Purified libraries were normalized by quantitative PCR (qPCR) using the KAPA Library Quantification Kit (KAPA Biosystems) and diluted to a final concentration of 10 nM ...
-
bioRxiv - Microbiology 2022Quote: ... Cell-clone colonies were tested for β-galactosidase expression to check viral infectivity (kit Roche #11758241001). Positive clones were transduced with the lentiviral vector (LV ...
-
bioRxiv - Molecular Biology 2022Quote: ... The purified pool was quantified by real-time PCR with the Kapa Biosystems Quantification Kit (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: DNA from liver and cell pellets was isolated using High Pure PCR Template Preparation Kit (Roche). DNA concentrations were measured by Nanodrop 2000c Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... qRT-PCR was conducted with the LightCycler 480 SYBR Green I Master kit (Cat. 04887352001, Roche). Primers used for qRT-PCR are listed in Supplementary Table 2 ...
-
RTEL-1 and DNA polymerase theta promote subtelomeric DNA synthesis and telomere fusion in C. elegansbioRxiv - Genetics 2022Quote: ... Probe was generated using the PCR DIG probe synthesis reaction kit (Roche cat# 11636090910, Basel, Switzerland). Tel2 (GAATAATGAGAATTTTCAGGC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Messenger RNA library construction was performed using the Kapa HyperPrep mRNA Stranded with Riboerase kit (Roche). Each indexed sample was pooled in equimolar amounts and sequenced on two lanes of a NovaSeq4000 with paired end 150 bp reads at the UT Arlington North Texas Genome Center ...
-
bioRxiv - Microbiology 2022Quote: ... Viral DNA was then extracted using the High Pure Viral Nucleic Acid Kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... and concentrations were determined using the Kapa SYBR FAST Universal qPCR kit for Illumina sequencing (Roche). Paired-end 75 cycle sequencing was completed using two Mid Output 150 cycle kits on the NextSeq 550 (Illumina).
-
bioRxiv - Plant Biology 2022Quote: ... The purified PCR products were used to construct libraries by the Kapa DNA Hyper Kit (Roche) together with TruSeq DNA UD indexes for Illumina (Illumina) ...
-
bioRxiv - Neuroscience 2023Quote: To detect DNA fragmentation in GFAP+ astrocytes an in situ cell death detection kit (Roche, 11684795910) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... Sst sense and antisense probes were transcribed using a DIG or FITC RNA labeling kit (Roche) and purified with RNA Clean & Concentrator (Zymo Research) ...