Labshake search
Citations for Roche :
3201 - 3250 of 7615 citations for 7 Methylimidazo 1 2 a pyridine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Antibody incubation was performed for 16 h at 4°C in AB buffer supplemented with 1% v/v Fetal Calf Serum and anti-DIG antibody coupled to alkaline phosphatase (1∶5000 dilution; Roche). Sections were then washed thoroughly in AB and equilibrated in alkaline phosphatase buffer (AP - 0.1 M Tris–HCl pH ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were lysed with glass beads in 250 µl RIPA buffer (25mM Tris/HCl pH 7.6, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS, Roche complete protease inhibitor cocktail; Roche PhosStop tablet) using a FastPrep (MP biomedicals) ...
-
bioRxiv - Biophysics 2023Quote: ... 5 mM CDTA pH 8.0, 0.5% Triton-X-100 supplemented with 1 mM ATP, 1 mM PMSF, and Roche protease inhibitors) for 75 mins on a nutating rocker ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM AEBSF, 1X Roche protease inhibitor, 1X Roche phosphatase inhibitor) followed by a 30’incubation on ice ...
-
bioRxiv - Neuroscience 2023Quote: Cell pellets were resuspended in a lysis solution composed by 1 X Phosphate Saline Solution (PBS) supplemented with 1 X Complete Protease Inhibitor Cocktail (Roche) and then sonicated with a BioRuptor UCD-200 (Diagenode ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed with protein lysis buffer (50 mM Tris-HCl, 250 mM NaCl, 5 mM EDTA, 1 mM Mg2Cl, 1% NP40 and supplemented with protease inhibitor cocktail, Roche), incubated on ice for 20 minutes and spun at 10,000 g for 10 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were lysed with protein lysis buffer (50 mM Tris-HCl, 250 mM NaCl, 5 mM EDTA, 1 mM Mg2Cl, 1% NP40 and supplemented with protease inhibitor cocktail, Roche), incubated on ice for 20 minutes and spun at 10,000 g for 10 min at 4 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... 1% [v/v] Triton X-100, 150 mM NaCl, 1 mM EDTA, 10% [v/v] glycerol, and 1× protease inhibitor cocktail [Roche]) by rotating at 4 °C for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell pellets were washed once then resuspended in a 1:1 ratio with CHAPS lysis buffer + protease inhibitors (Roche Complete) and frozen dropwise in liquid nitrogen before freezer-mill lysis ...
-
bioRxiv - Plant Biology 2024Quote: ... 100 mM NaCl, 80 mM KCl, 1% glycerol, 0.1 % Triton, 10 mM DTT, plus 1 mini protease inhibitor cocktail tablet, Roche, Switzerland) per 20 ml of extraction buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Genetics 2019Quote: ... The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche, Mannheim, Germany, code#06402712001), 2 μl diluted reverse transcriptase product (1:100) ...
-
bioRxiv - Neuroscience 2019Quote: 88 μL of sample was subjected to RNase-free DNaseI treatment by the addition of 10 μL of 10X Buffer and 2 μL of RNase-free DNaseI (Roche 04 716 728 001) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1 x phosphatase inhibitor cocktail (PhosSTOP, Roche). Total protein concentration was determined with Bradford protein assay kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 μg ml−1 of DNase (Roche, #10104159001), 50 μg ml−1 of RNase (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse monoclonal to GFP (Roche #11814460001, 1:2000), Rabbit monoclonal to LRRK2 phospho-S1292 (Abcam #ab203181 ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... and 1 tablet of phosphatase inhibitor PhosSTOP (Roche)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM PMSF and protease inhibitor cocktail (Roche). Cells were scrapped and passed through a syringe with needle gauge 26 several times avoiding foam ...
-
bioRxiv - Cell Biology 2020Quote: ... rhodamine α-DIG Fab fragments (Roche 1:20) followed by Texas Red α-sheep antibody (Vector Labs ...
-
bioRxiv - Cell Biology 2019Quote: ... 1% Triton-X100 and protease inhibitors (Roche Diagnostics). of clarified lysate was obtained by centrifugation at 16,000xg 15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-GFP (1:200 dilution; Roche, 11814460001) was used for staining Cse4-GFP and rat anti-HA (1:200 dilution ...
-
bioRxiv - Developmental Biology 2021Quote: ... slides were blocked with 1% blocking reagent (Roche) for 1 h at RT ...
-
bioRxiv - Genetics 2020Quote: ... 1 mM EDTA and proteinase inhibitor (cOmplete, Roche) for 30 min at 4 °C on a rocking platform followed by centrifugation at 15,000 rpm for 15 min at 4 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 mg/ml yeast tRNA (Cat. # 10109509001, Roche), 1×Denhardt’s [1% (w/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1× complete protease inhibitor cocktail (Roche, Lot # 3024150)] ...
-
bioRxiv - Biophysics 2022Quote: ... 1 cOmplete EDTA free protease inhibitor tablet (Roche) per 50 ml Buffer L ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with collagenase (Roche, 11088793001, 1 mg/mL) and hyaluronidase (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 mM EGTA and protease inhibitors (Roche Diagnostics). For homogenization ...
-
bioRxiv - Molecular Biology 2020Quote: ... GFP 1:1000 dilution (Roche 11814460001 Lot# 27575600). After three five-min washes with gentle rotation in blocking buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 × cOmplete EDTA-free protease inhibitor cocktail (Roche) and 0.5 U/µl RNasin (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1×EDTA-free protease inhibitor cocktail (Roche) (Guo et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% glycerol) containing protease inhibitors (1:100, Roche) for 45 min on a rotor at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... Dispase II (Roche, 1 mg/ml, Cat. No.SCM133) and Dnase I (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... in the presence of 1 mM dATP (Roche) and 40 U of RNAseOUT (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.1% SDS containing protease inhibitors (1 tablet Roche cOmplete protease inhibitor cocktail (#11836145001 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.1% SDS) with protease inhibitors (1 tablet Roche cOmplete protease inhibitor cocktail per 25 ml of FA lysis buffer ...
-
bioRxiv - Pathology 2019Quote: ... containing 1× cOmplete™ Protease Inhibitor Cocktail (Roche), followed by 10sec homogenization using a ProScientific Bio-Gen Pro200 homogenizer.
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM PMSF and Complete (Roche, Branchburg, NJ) protease inhibitor cocktail) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cell proliferation was assessed using WST-1 (Roche) 48 h after seeding.
-
bioRxiv - Developmental Biology 2020Quote: ... and HA at 1:100 (Rat, Roche, #11867423001), V5 at 1:1000 (mouse ...