Labshake search
Citations for Roche :
3101 - 3150 of 7401 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Ion channel function of polycystin-2/polycystin-1 heteromer revealed by structure-guided mutagenesisbioRxiv - Biophysics 2024Quote: ... Oocytes were subsequently transferred into 1 mL lysis buffer (Tris 25mM, NaCl 150 mM, EDTA 1mM, NP40 1%, Glycerol 5%, supplemented with Roche cOmplete™ protease inhibitor cocktail ...
-
bioRxiv - Biochemistry 2024Quote: Cells were resuspended in cold lysis buffer (50 mM Hepes pH 8, 50 mM NaCl, 5 mM MgCl2 and 1 tablet 50 mL−1 EDTA-free protease inhibitor, Roche) plus 0.5 mg/mL lysozyme and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 mg of fly heads from each genotype was homogenized in 2.9 ml of lysis buffer (8 M urea, 1% SDS, 1× PBS, 50 mM N-ethylmaleimide from Sigma, and a protease inhibitor cocktail from Roche). After the centrifugation of lysates at 16,000g at 4 ºC for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed in PBS and resuspended in ice cold lysis buffer (PBS supplemented with 50 mM NaCl, 1% Triton X-100, and 1× Complete EDTA-free protease inhibitor cocktail (Roche), incubated on ice for 15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... mixed and seeded at 2 x 106 cells/μm2 on glass bottom petri dish (Iwaki) coated with fibronectin (Roche, 1hour incubation, 25 μg/mL) or on fibronectin-micropatterned substrates ...
-
bioRxiv - Immunology 2021Quote: ... This lysate was incubated at 37 °C for 80 minutes and samples subsequently diluted in ice-cold DISC buffer (containing 2 mM NEM and Roche complete protease-inhibitor cocktail), cleared by centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.2 μM of both reverse and forward primers and the PCRs were run on a Roche Lightcycler 480 thermocycler (Roche Applied Science, Basel, Switzerland). Each sample and primer pair was run in triplicates ...
-
bioRxiv - Genomics 2021Quote: ... then washed and resuspended in Wash buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine and Roche complete EDTA-free protease inhibitor), aliquoted with 10% DMSO and slow-frozen to −80°C in Mr ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biochemistry 2022Quote: ... The pellet was resuspended in 50 mL lysis buffer (20 mM Tris pH7.5, 200 mM NaCl, 2 mM β-mercaptoethanol, 10% glycerol, protease inhibitor cocktail (Roche, as directed by manufacturer), 20 mM imidazole) ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Physiology 2024Quote: ... and homogenised with 650-800 mg silica beads for 2× 30 second homogenisation steps at 6500 rpm (MagNA lyser, Roche Diagnostics, North Ryde, Australia). RNA was extracted from the homogenised lysate using an Allprep DNA/RNA/miRNA Universal extraction kit (#80224 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Tissues were solubilized in lysis buffer (125 mM Tris-HCl pH 6.8, 2% SDS, 0.01% β-mercaptoethanol, cOmplete Mini EDTA-free (Roche, cat. 04 693 159 001)) ...
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1 x phosphatase inhibitor cocktail (PhosSTOP, Roche). Total protein concentration was determined with Bradford protein assay kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 μg ml−1 of DNase (Roche, #10104159001), 50 μg ml−1 of RNase (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse monoclonal to GFP (Roche #11814460001, 1:2000), Rabbit monoclonal to LRRK2 phospho-S1292 (Abcam #ab203181 ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... and 1 tablet of phosphatase inhibitor PhosSTOP (Roche)) ...
-
bioRxiv - Cell Biology 2020Quote: ... rhodamine α-DIG Fab fragments (Roche 1:20) followed by Texas Red α-sheep antibody (Vector Labs ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-GFP (1:200 dilution; Roche, 11814460001) was used for staining Cse4-GFP and rat anti-HA (1:200 dilution ...
-
bioRxiv - Developmental Biology 2021Quote: ... slides were blocked with 1% blocking reagent (Roche) for 1 h at RT ...
-
bioRxiv - Genetics 2020Quote: ... 1 mM EDTA and proteinase inhibitor (cOmplete, Roche) for 30 min at 4 °C on a rocking platform followed by centrifugation at 15,000 rpm for 15 min at 4 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 mg/ml yeast tRNA (Cat. # 10109509001, Roche), 1×Denhardt’s [1% (w/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1× complete protease inhibitor cocktail (Roche, Lot # 3024150)] ...
-
bioRxiv - Biophysics 2022Quote: ... 1 cOmplete EDTA free protease inhibitor tablet (Roche) per 50 ml Buffer L ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with collagenase (Roche, 11088793001, 1 mg/mL) and hyaluronidase (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 mM EGTA and protease inhibitors (Roche Diagnostics). For homogenization ...
-
bioRxiv - Molecular Biology 2020Quote: ... GFP 1:1000 dilution (Roche 11814460001 Lot# 27575600). After three five-min washes with gentle rotation in blocking buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 × cOmplete EDTA-free protease inhibitor cocktail (Roche) and 0.5 U/µl RNasin (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% glycerol) containing protease inhibitors (1:100, Roche) for 45 min on a rotor at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... Dispase II (Roche, 1 mg/ml, Cat. No.SCM133) and Dnase I (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... and HA at 1:100 (Rat, Roche, #11867423001), V5 at 1:1000 (mouse ...
-
bioRxiv - Biophysics 2021Quote: ... and 1 EDTA-free protease inhibitor tab (Roche)) and sonicated for a total of 2 minutes (20 sec on and 40 sec off intervals ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM PMSF and protease inhibitor cocktail (Roche). The Pierce BCA kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... 1 Unit Kapa HiFi polymerase (KK2102, Roche, UK), 1x Kapa HiFi Fidelity buffer (KK2102 ...
-
bioRxiv - Cell Biology 2021Quote: ... 1:500 lysozyme and protease inhibitor cocktail (Roche). Lysates were then cleared by centrifugation (20,000 × g at 4°C for 10 mins ...
-
bioRxiv - Neuroscience 2020Quote: ... or rat anti-HA (Roche 11867423001, 1:250) in blocking buffer at 4°C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... and 20 μg mL-1 DNAse I (Roche) in 1x Hanks’ balanced salt solution (HBSS ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-GFP (WB, 1:1000, Roche, 11814460001), rabbit anti-GFP (WB ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM DTT) supplemented with protease inhibitors (Roche Complete Ultra EDTA-free tablets ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM DTT) supplemented with protease inhibitors (Roche Complete Ultra tablets ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% Triton X-100) containing protease inhibitors (Roche). Protein concentrations were measured with the Bio-Rad Protein Assay ...
-
bioRxiv - Cell Biology 2021Quote: ... 1× complete Mini protease inhibitor cocktail (Roche Diagnostics), 1 mM PMSF ...
-
bioRxiv - Cell Biology 2021Quote: ... 1× complete Mini protease inhibitor cocktail (Roche Diagnostics), 1 mM PMSF] and collecting cleared lysates by centrifugation at 13,400 g at 4°C for 20 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 % (w/v) hyridization blocking reagent (Roche, 339450), 0.3 % (v/v ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% Triton X-100 and protease inhibitors (Roche)) for 1 hour at 4°C on a rocking platform ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM CaCl2 and protease inhibitor tablet (Roche), and cleared by centrifugation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM CaCl2 and protease inhibitor tablet (Roche), and cleared by centrifugation ...