Labshake search
Citations for Roche :
3101 - 3150 of 8268 citations for 1 5 Bis 2 2 methyl 1 oxoallyl oxy ethyl dihydrogen benzene 1 2 4 5 tetracarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM of each dNTP (Roche, NTMIXKB), 0.25 µM biotinylated oligo-dT30VN (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 1× PhosSTOP phosphatase inhibitor (Roche, 4906845001). Cell lysates were vortexed and centrifuged ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 tablet of cOmplete protease inhibitor (Roche), and 1.25 µg/mL DNase I (Roche) ...
-
Defining short linear motif binding determinants by phage-based multiplexed deep mutational scanningbioRxiv - Biochemistry 2024Quote: ... Protease Inhibitor tablet (Roche, 1 tablet/10mL)) ...
-
bioRxiv - Biochemistry 2024Quote: ... with 1× Protease inhibitor cocktail EDTA (Roche) and 1× PhosSTOP (Roche) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1× Complete protease inhibitor cocktail (Roche). Cells were lysed via sonication and the lysate cleared by centrifugation at 30,000 x g for 30 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 1× Pierce phosphatase inhibitor (Roche, 4906845001) for 5 minutes on ice ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 1 mg/ml collagenase A (Roche) for 15 min at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mg/ml DNase I (Roche, 10104159001) and 0.5x Glutamax in 2 ml Hibernate A without calcium (BrainBits ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-GFP (1:2000, mouse, Roche 1814460) and anti-Tubulin (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... 1:1000 anti-GFP (Mouse, Roche 11814460001).
-
bioRxiv - Genetics 2021Quote: Mouse bi-clonal anti-GFP antibody (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:50 in dH2O and mixed with an equal volume of target-specific primers and Roche 2×SYBR master mix (Roche, Cat No.04707516001). Plates were centrifuged at 1000 rpm for 1 min and stored at 4°C in the dark until ready for use ...
-
bioRxiv - Developmental Biology 2022Quote: ... but with several differences from incubation with the anti-DIG antibody on: Incubation with blocking Buffer (2% Blocking Reagent from ROCHE in MABTween 1x) for 1 h ...
-
bioRxiv - Genomics 2020Quote: ... SeqCap library preparation was performed using custom Nimblegen SeqCap probes (described above in §2.1) according to the NimbleGen SeqCap EZ HyperCap Workflow User’s Guide Ver 2 (Roche Sequencing Solutions, Inc., CA USA). Following capture ...
-
bioRxiv - Microbiology 2020Quote: Deidentified remnant patient samples that underwent routine clinical testing with the cobas SARS-CoV-2 assay on the 6800 platform (Roche Diagnostics, Indianapolis, IN) were used to evaluate the Xpert and ID Now assays ...
-
bioRxiv - Microbiology 2021Quote: ... 1% Triton X-100, 150 mM NaCl, 10% glycerol, and 2 mM EDTA plus one Complete EDTA-free protease inhibitor tablet [Roche] per 50 ml) for 1 hr ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Cell Biology 2022Quote: ... triton X-100 in HBSS for 10 min and incubated with blocking solution containing 2% (w/v) bovine serum albumin fraction V (Roche, Woerden, The Netherlands) and 0.1% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
bioRxiv - Cell Biology 2021Quote: ... using 2 μL of the diluted cDNAs and the KAPA SYBR ® FAST qPCR Kit Optimized for Light Cycler ® 480 (KAPA biosystems). Differences between samples and controls were calculated based on the 2−ΔCT method ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 12.5 ng of purified DNA from each sample was used as a template for PCR amplification in 25 μl reaction mixture by using 2 × KAPA HiFi Hot Start Ready Mix (Kapa Biosystems, MA, USA). For PCR amplification ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK293 cells were transiently transfected with β-arrestin 2-Renilla luciferase 8 (Rluc8) and human C5aR2-Venus constructs using XTG9 (Roche, Sydney, Australia) for 24 h ...
-
bioRxiv - Physiology 2020Quote: ... finely cut with scissors and incubated in digestion medium (PBS with 2% BSA, 1M CaCl2, 94U/ml dispase II and 100mg/ml collagenase D, Roche Life Science, France) at 37°C for 30-40min ...
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates were extracted with phosphate-buffered saline (PBS) containing 2 % Triton X-100 and protease inhibitors (Roche Complete, Roche Diagnostics, Mannheim, Germany). Protein concentrations were determined by BCA-assay (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Microbiology 2023Quote: Capture-based libraries were prepared following the KAPA RNA HyperCap workflow with specific enrichment probes for SARS-CoV-2 (Roche Diagnostics, Mannheim, Germany). Each individual library was created using 10ul of extracted RNA input and following the protocol established by the kit’s manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 0.09 ng of cDNA per well was used in qRT-PCR with KAPA SYBR® FAST qPCR Master Mix Kit (2×) (KAPA Biosystems, USA) on an Applied StepOnePlusTM Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 50-200 mL of room temperature Ribosome Lysis Buffer supplemented with 2 EDTA-free protease inhibitor tablets (Roche, Catalog Number 04693132001), Turbo DNAse (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... the lysate powder was resuspended in 100-200 mL of room temperature eIF3 Lysis Buffer supplemented with 2 ethylenediamine tetraacetic acid (EDTA)-free protease inhibitor tablets (Roche, Catalog Number 04693132001), 20 mM imidazole ...
-
bioRxiv - Cancer Biology 2024Quote: ... To maintain the carryover ≤ 20% with intra-day and inter-day (2 d) CV%≤ 20% acceptable for bioanalytical assays ((Clouser-Roche et al., 2008), it was necessary to perform intermediate a post-run wash injection following each standard and sample injection ...
-
bioRxiv - Microbiology 2024Quote: ... 12 ng of genomic DNA was amplified in a 25 µL reaction comprised of 2x Kapa HiFi Master Mix (Roche cat # KK2601/2), 1 µL of 10 µM V4 515F/806R primers with Illumina adapters (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGYCAGCMGCCGCGGTAA -3’ ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was discarded and the pure nuclear pellets were resuspended in boiling buffer (100mM Tris pH8.0, 2% SDS, 100μM PUGNAc, and Roche EDTA-free protease inhibitor cocktail) [59] ...
-
bioRxiv - Biophysics 2024Quote: ... Purified motor proteins were diluted to indicated concentrations in the assay buffer with 2 mM of corresponding nucleotides (ATP-Chem Imex, ADP-Sigma Aldrich, or AMPPNP-Roche Diagnostics GmbH)fr ...
-
bioRxiv - Developmental Biology 2024Quote: ... eighty nanograms of cDNA products were amplified for another five PCR cycles using KAPA HiFi HotStart Uracil 2 x ReadyMix (Kapa Biosystems, Cat. KK2602) and designed primers Biotin-ACTAG/ideoxyU/CTACACGACGCTCTTCCGATCT and ACTAG/ideoxyU/AAGCAGTGGTATCAACGCAGAG ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies to the spike protein receptor binding domain and nucleocapsid were measured by the Roche Elecsys Anti-SARS-CoV-2 S and Anti-N assay (Roche Diagnostics, Indianapolis, IN), per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Cell lysis was carried out in MES-lysis buffer (50 mM MES/NaOH pH 6.5, 150 mM NaOH, 1% Triton, 1 mM EDTA, Complete EDTA free (Roche)) by beating using a Fast Prep 24 instrument (MP Biomedicals ...
-
bioRxiv - Cell Biology 2020Quote: ... was carried out using MES lysis buffer (50 mM MES/NaOH pH 6.5, 150 mM NaOH, 1% Triton, 1 mM EDTA, Complete EDTA free (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 mM NaCl; 1 mM EDTA, 1% Triton-X or 0.1% NP-40; supplemented with Complete Mini protease inhibitors, Roche). Cell lysates were cleared by centrifugation (3x 10 min at 20000 g at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the resulting crude synaptosome fraction was then resuspended in IP buffer (50 mM Tris pH 7,4; 100 mM NaCl; 1 mM EDTA, 1% Triton-X; supplemented with Complete Mini protease inhibitors, Roche) and cleared by 3x centrifugation at 20000 g ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% Triton X-100 and 0.1% SDS) with a protease inhibitor cocktail (Roche/1 tablet in 10 mL RIPA). Homogenates were centrifuged for 5 min at 4°C at 13,000 x G ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5% NP-40 and 1 mM EDTA supplemented with 1 × protease inhibitor complete mini EDTA-free cocktail from Roche). The supernatants of cell lysates were boiled for 5 min in 1 × SDS loading buffer (6 × ...
-
bioRxiv - Physiology 2020Quote: ... buffer (10 mM Tris [pH 7.5], 1 mM EDTA, 250 mM sucrose, 1 mM dithiothreitol [DTT], plus protease and phosphatase inhibitor cocktail [Roche]). Homogenates were centrifuged at 100,000 ×g for 1 h at 4 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell pellets were resuspended and bead beaten in 250 μL urea buffer (6 M urea, 1% SDS, 50 mM Tris-HCl pH 6.8, 1 mM EDTA, 2x Roche protease inhibitors ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% v/v NP-40, 0.1% w/v SDS, 1% w/v sodium deoxycholate, 1× complete mini-protease mixture; Roche), and incubated on ice for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... pH = 7.6; 150 mM NaCl; 1 mM EDTA; 10% glycerol; 1% Nonidet P40 Substitute; protease inhibitor cocktail [Roche]; PhosSTOP [Roche]), using a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were treated with a commercially available collagenase/dispase mixture (1 mg·ml-1, 269638, Roche Diagnostics, Mannheim, Germany) and hyaluronidase (1 mg·ml-1 ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 7.4) supplemented with 1 % Triton X-100 and protease inhibitor (Roche, 1 tablet per 100 ml lysis buffer) by gentle rocking at 4 °C for 20 min ...
-
bioRxiv - Developmental Biology 2020Quote: VcanTg(Hoxa1)1Chm (Vcanhdf) mice [25] (Figure-1 Supplement 1) were obtained under a material transfer agreement from Roche. Generation of Has1−/−;Has3−/− double knockout mice was described previously [67] ...
-
bioRxiv - Microbiology 2021Quote: ... resuspended with 1 mL lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl PH7.0, freshly added 1 mM PMSF, complete protease inhibitor [Roche]) for 10 min at 4°C and subjected to sonication to fragment the genomic DNA in size range of 300-700 base pair ...