Labshake search
Citations for Roche :
2951 - 3000 of 6198 citations for Mouse Serine threonine Protein Kinase 17B STK17B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Linear NGS library construction was performed using a KAPA HyperPrep library kit (Roche) according to published protocols ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... constructed barcoded libraries for sequencing using KAPA HyperPrep kits (Roche Sequencing, Pleasanton, CA) with a target fragment size of 500 bp ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation was performed using a commercially available kit provided by KAPA Biosystems (KAPA Hyper Prep with Library Amplification Primer Mix ...
-
bioRxiv - Genomics 2022Quote: Libraries are quantified via qPCR using the KAPA Library Quantification Kit (Roche 0796020400), which specifically analyzes sequencing-competent fragments ...
-
bioRxiv - Genomics 2022Quote: BANC-seq libraries were prepared using the Kapa Hyper Prep Kit (Kapa Biosystems) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was done with the SYBR Green I Master kit (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... LDH release levels were analyzed using a Cytotoxicity Detection Kit (Roche, Basel, Switzerland). Purified Ply(1μM)was co-cultured with various concentrations of alnustone at 37°C for 30min ...
-
bioRxiv - Microbiology 2022Quote: ... The KAPA HiFi Hot Start Ready Mix kit (Kapa Biosystems, Woburn, MA, USA) was used for PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Microbiology 2022Quote: ... JE1 amylase activities were measured in culture supernatants using the AMYL kit (Roche/Hitachi #11876473 001 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was generated by using the Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was performed using FastStart SYBR green master mix (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.
-
bioRxiv - Pathology 2022Quote: ... and quantified using the KAPA Library quantification kit for Illumina platforms (KAPA Biosystems). One hundred base pair single-read sequencing of multiplexed samples was performed on an Illumina HiSeq 4000 sequencer ...
-
bioRxiv - Plant Biology 2022Quote: ... The library was quantified with the KAPA Library Quantification Kit (Roche, Basel, Switzerland), and the fragment size of the library was verified using an Agilent Technology 2100 bioanalyzer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mRNA was isolated with an mRNA Isolation Kit (Roche, # 11 741 985 001) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the LightCycler Fast Start DNA Master SYBR Green I kit (Roche Diagnostics) as previously described (Maire et al. ...
-
bioRxiv - Microbiology 2022Quote: ... LDH in the cell supernatants was quantified using the Cytotoxicity Detection kit (Roche), following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The libraries were constructed using the KAPA HyperPlus Library Preparation Kit (KAPA Biosystems) and sequenced using the Illumina HiSeq 4000 platform (with 150 bp paired-end reads) ...
-
bioRxiv - Microbiology 2023Quote: ... with a KABA SYBR Fast Universal qPCR Kit (Kapa Biosystems, Wilmington, MA, USA) was used for quantification ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were quantified using the KAPA qPCR quantification kit (KAPA Biosystems, Wilmington, MA) and sequenced on an Illumina HiSeq 2500 producing single end 50 base pair reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the LightCycler FastStart DNA Master SYBR Green I kit (Roche Diagnostics, 03003230001). The amplification condition for Oct3/4 was 10 min at 95ºC for one cycle ...
-
bioRxiv - Microbiology 2022Quote: ... using commercial kits adapted for a COBAS 6000 autoanalyzer (Roche Diagnostics, Rotkreuz, Switzerland). Radiolabeled HDLs were prepared as previously described24 ...
-
bioRxiv - Microbiology 2022Quote: ... the cell viability was assessed by using the XTT kit (Roche Applied Science) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Hybridization reactions were washed using SeqCap Hybridization and Wash Kit (Roche, Cat#: 05634261001) and DNA eluted in 50μL molecular grade water ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA extraction was performed by using the HighPure FFPET RNA extraction kit (Roche). RNA concentration and quality were assessed on the Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2022Quote: ... DNA libraries were quantified via qPCR using a KAPA Library Quantification kit (Roche Sequencing and Life Science ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted using the HighPure RNA Isolation kit (Roche, Mannheim, Germany; # 11828665001) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Digoxigenin-labelled RNA probes were prepared using a DIG Northern Starter Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... LDH released in the supernatant was detected using a cytotoxicity detection kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA probe was labelled using a DIG oligonucleotide tailing kit (Roche, Germany), as per the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... Reaction was performed with FastStart Universal SYBR Green Master Kit with Rox (Roche). Normalized to expression of HPRT level ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted with the High Pure miRNA Isolation Kit (Roche Diagnostics) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was synthesized using a Transcriptor first-strand cDNA synthesis kit (Roche) and RT-qPCR was performed using SYBR green master mix (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was synthesized using a Transcriptor first-strand cDNA synthesis kit (Roche). Primers for fur (Table 1 ...
-
bioRxiv - Microbiology 2024Quote: ... These libraries were prepared with the Kapa Hyper Stranded mRNA library kit (Roche). All samples were pooled and run on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The prepared libraries were then quantified using KAPA Illumina library quantification kit (Roche) and run on a LightCycler 480 real-time PCR instrument (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was amplified using the 2X KAPA Taq ReadyMix PCR Kit (KAPA Biosystems, now Roche Sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: NB was performed according to the manufacturer’s protocol (DIG Northern Starter Kit, Roche). Digoxigenin (Dig)-labeled antisense riboprobes were produced using using T7 RNA polymerase by in vitro transcription with RiboMAX Large Scale RNA Production Systems (Promega) ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with the In Situ Cell Death Detection Kit Fluorescein mix (Roche) at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... Using the KAPA Library Quantification kit for Illumina platforms (KAPA Biosystems, Wilmington, MA), libraries were quantitated and pooled equimolarly ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA was prepared using the Transcriptor High Fidelity cDNA Synthesis kit (Roche). 1000 ng of RNA was used for reverse transcription in a 6.5 µl reaction using the iTaq Universal SuperMix Two-step kit (Biorad ...
-
bioRxiv - Microbiology 2024Quote: ... RNA-seq libraries were prepared using the KAPA RNA stranded Kit (Roche-Nimblegen), and their quality and quantity were assessed with a BioAnalyzer using the High Sensitivity DNA Kit (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: Reverse transcription was performed using the Transcriptor First Strand cDNA Synthesis Kit (Roche) with oligo d(T ...
-
bioRxiv - Evolutionary Biology 2023Quote: Long-range PCR was conducted using a KAPA LongRange HotStart Kit (KAPA Biosystems) in 25 µl volumes with 24 µl Master-mix (ultra-pure MilliQ water ...
-
bioRxiv - Plant Biology 2023Quote: ... and quantification was performed using a KAPA Library Quantification kit (Roche, cat#KK4824). Libraries were sequenced on a NextSeq500 platform using a 2x150bp high output run ...
-
bioRxiv - Plant Biology 2023Quote: ... and quantification was performed using a KAPA Library Quantification kit (Roche, cat#KK4824). Libraries were sequenced on a NextSeq500 platform using a 1x76bp run ...
-
bioRxiv - Immunology 2024Quote: ... and their concentrations were measured using the KAPA SYBR Fast qPCR kit (Roche). Samples were sequenced on the NovaSeq 6000 instrument (paired end ...
-
bioRxiv - Molecular Biology 2024Quote: ... and by qPCR using KAPA Library Quantification Kit for Illumina® Platforms (Roche). Library size was determined with Agilent Bioanalyzer 2100 system using the Agilent High Sensitivity DNA Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... and by qPCR using KAPA Library Quantification Kit for Illumina® Platforms (Roche). Library size was determined with Agilent Bioanalyzer 2100 system using the Agilent High Sensitivity DNA Kit ...