Labshake search
Citations for Roche :
2951 - 3000 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Each final pooled library was quantified by qPCR with the KAPA Library Quantification Kit (KAPA Biosystems, USA) and sequenced using the Illumina paired-end protocol on a HiSeq3000 sequencer by the Get-PlaGe core facility (GenoToul platform ...
-
bioRxiv - Neuroscience 2024Quote: ... using TGGAGCTGTTACCCACATCA and GCACAGTTCAGCGGGTACTT primers followed by a melting point analysis using the High Resolution Melting and Gene scanning application on the LightCycler 480 (Roche Diagnostics) was performed according to [3] ...
-
bioRxiv - Neuroscience 2024Quote: ... EDTA-free complete mini–Protease Inhibitor Cocktails were from Roche (Indianapolis, IN). Pierce bicinchoninic acid (BCA ...
-
bioRxiv - Molecular Biology 2024Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Cancer Biology 2024Quote: ... HSJD-DIPG-012 and HSJD-DIPG-014 cell lines by real-time quantitative QRT-PCR on a LightCycler® 480 instrument (Roche) using a RT² Profiler PCR Array (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the LightCycler® 480 SYBR Green I Master Mix (Roche, 04707516001), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... were assessed by real-time quantitative QRT-PCR on a LightCycler® 480 instrument (Roche) using the LightCycler® 480 SYBR Green I Master Mix (Roche ...
-
bioRxiv - Cell Biology 2024Quote: Human peripheral blood mononuclear cells isolated from buffy coats were activated in vitro for 1 week with 20 U/ml of IL-2 (Teceleukin; Roche, Nutley, NJ) and 5 μg/ml phytohemagglutinin (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... life-Tein LLC) was mixed with 50µl of PBS containing 1% Tween20 and 5ng/mL anti-HA-Peroxidase 3F10 antibody (Roche #12013819001) and transferred to the wells ...
-
bioRxiv - Neuroscience 2024Quote: ... The cell pellet was resuspended (20 mL/L culture volume) in lysis buffer (20 mM Tris pH 8, 150 mM NaCl, and protease inhibitor cocktail, Roche). These resuspended cells were disrupted using sonication (QSonica sonicator ...
-
bioRxiv - Developmental Biology 2024Quote: ... In vitro transcription was performed using a T7 polymerase and DIG-labeled nucleotides (Roche). RNAscope was performed on sectioned zebrafish larvae as previously described (Carroll ...
-
bioRxiv - Immunology 2024Quote: ... Left lung lobes were dissociated by enzymatic digestion with 1 mg/mL collagenase D (Roche, 11088882001), and 1 mg/mL collagenase IV (Worthington Biochemical ...
-
bioRxiv - Genetics 2024Quote: ... as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA). The libraries were multiplexed and clustered onto two flowcells and were loaded onto an Illumina HiSeq 4000 instrument ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor cocktail (Roche), 1 μM phenylmethanesulfonyl fluoride ...
-
bioRxiv - Molecular Biology 2024Quote: ... and EDTA-free proteinase inhibitor (Roche)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Eluted mRNA was then reverse transcribed using random hexamer primers and Transcriptor First Strand cDNA Synthesis Kit (#04897030001, Roche) at 65°C for 10 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein visualization was performed by chemiluminescence using LumiLight western blotting (Roche) and ImageQuant 800 (GE Healthcare) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 100,000 worms were collected in 1 ml of RIPA buffer (50 mM Tris HCl pH 7.4, 150 mM NaCl, 1% Nonidet NP-40, 0.1% SDS, 0.5% Sodium deoxycholate, Roche cOmplete EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Neuroscience 2024Quote: ... and three times with low salt buffer (20 mM Tris HCl pH 7.4, 10mM MgCl2, 0.2% Tween-20, Roche Protease Inhibitor and RNase Inhibitor). To elute RNA ...
-
bioRxiv - Neuroscience 2024Quote: ... The agarose resin was washed once with high salt buffer (50 mM Tris HCl pH 7.4, 1M NaCl, 1 mM EDTA, 1% Nonidet NP-40, 0.1% SDS, 0.5% Sodium deoxycholate, Roche cOmplete EDTA-free Protease Inhibitor Cocktail and RNase Inhibitor ...
-
bioRxiv - Microbiology 2024Quote: ... 150 mM NaCl and protease inhibitors mixture (Roche Diagnostics) for 30 min at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with protease inhibitors (Complete Mini EDTA-free, Roche). After sonication ...
-
bioRxiv - Cancer Biology 2024Quote: ... donor sequences were cloned into a cloning vector and PCR amplification (25 cycles) was performed using Kapa-HiFi polymerase (Roche). DNA purification was performed by solid-phase reversible immobilization using AMPure XP (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... The remaining 90% of each sample was immunoprecipitated with 1:1000 anti-HA antibody (0.5 mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Cell Biology 2024Quote: ... protease inhibitors (Roche cOmplete Protease Inhibitor Cocktail). As a last step the inclusion bodies pellet was washed in a buffer containing 10 mM Tris HCl pH 8 ...
-
bioRxiv - Microbiology 2024Quote: ... protease inhibitor and PhosSTOP (Roche®) phosphatase inhibitor (37).
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in this buffer containing 0.1 mM biotin-dUTP (Roche, #11093070910) for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... Mini (Roche®) protease inhibitor and PhosSTOP (Roche® ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2024Quote: ... Aliquots (+Ab) were incubated with 5 µg antibody [anti-HA (3F10, Roche) or anti-MYC (AB9106 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were lysed in radioimmunoprecipitation assay buffer containing complete protease inhibitor cocktail (Roche, Basel, Switzerland) on ice and ultracentrifuged ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2024Quote: ... 1 mM PMSF and 1X PIC (Protease Inhibitor Cocktail, Roche). An equal volume of glass beads was added and cells were lysed in a mini bead beater (BIOSPEC ...
-
bioRxiv - Cell Biology 2024Quote: ... and phosphatase inhibitor cocktail (PhosSTOP, Roche, catalog no. 04 906 837 001). Proteins in Laemmli sample buffer that contained 50 mM dithiothreitol (DTT ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2024Quote: ... mouse anti-HA (12CA5 and 3F10, Roche), HRP-conjugated goat anti-mouse IgG (Jackson) ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2024Quote: ... The primary antibodies used: rat anti-HA (3F10, Roche), mouse anti-HA (12CA5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were incubated for 1.5h in PBSTw-1%BSA before being incubated with anti-DIG-POD antibody (Roche, 1:2000) and other primary antibodies o/n at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... dissected hindbrains were fixed in 4% PFA for 1 hour (and stored up to 3 months) and stained as previously described (Myat et al., 1996) using a digoxygenin-labelled riboprobe (Roche) against the target mRNA sequence (Table 3) ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were incubated in 50% Hybridization Buffer (50% formamide, 2x SSC, 1 mg/ml Torula RNA, 0.05 mg/ml Heparin, 2% Roche blocking reagent ...
-
bioRxiv - Developmental Biology 2024Quote: ... Segments of the fibulas were digested using collagenase A (Roche, 10103578001) used at 0.1 mg/mL treatment for 40 minutes with replacement of collagenase A midway at 20 minutes and then digested with 0.2 mg/ml of collagenase A for 60 minutes at 37°C with intermittent shaking.
-
bioRxiv - Developmental Biology 2024Quote: ... harvested and lysed 14 h later in 300 µl binding buffer (20 mM HEPES pH 7.6, 150 mM MgCl2, 10% glycerol, 0.05% NP-40, 1 mM DTT, ROCHE cOmpleteTM ULTRA-tablet Mini protease inhibitor) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The same proportion of cDNA products of each sample was used as template for the quantitative RT-PCR reaction with Light Cycler 480 SYBR Green I Master Mix (Roche, 04707516001). The Ct value was used to represent the absolute amount of EU-RNAs in each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... neoformans 150 TF mutant strains (44) was subjected to DNAse I treatment (Roche) to eliminate contaminating genomic DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μL 20 mg/mL Glycogen (Roche, 10901393001)) at 37°C for 2 hr and subsequently subjected to Proteinase K (15 μL 10% SDS ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 x proteinase inhibitor cocktail (Roche, Germany). After centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: Whole cell extracts from cultured cells were prepared by direct lysis and sonication of cells in 2% SDS sample buffer containing phosphatase and protease inhibitors (Roche, Germany). Cell extracts were separated in denaturing 8% or 15% (used only for CDKN1A ...
-
bioRxiv - Molecular Biology 2024Quote: Tissue extracts were prepared by sonication in PBS containing 1x protease inhibitor cocktail (Roche). An aliquot was removed for protein determination by the Qubit assay ...
-
bioRxiv - Cell Biology 2024Quote: ... and SYBR Green I Master Kit (Roche; Cat #04887352001) was used to carry out the reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 μg of total RNA was retro-transcribed using Transcriptor First Strand cDNA Synthesis Kit (Roche; Cat #04897030001) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... EDTA-free Protease Inhibitor Cocktail (Roche, Cat #11873580001), 1 mM PMSF ...
-
bioRxiv - Cell Biology 2024Quote: ... qRT-PCR was performed using the LightCycler 480 system (Roche). Relative expression levels were calculated as 2-ΔCT normalized with the average CT of the housekeeping gene Tbp or Gapdh ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins with HA-tag(s) were detected using rat mAb-anti-HA 3F10 (Roche, 1:1000) as primary antibody and IRDye® 800CW Goat anti-Rat IgG (Licor ...