Labshake search
Citations for Roche :
251 - 300 of 1185 citations for pIEXBac c EGFP 3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Human TGs were measured using the Cobas c 501 analyzer (Roche Diagnostic). For this purpose ...
-
bioRxiv - Cancer Biology 2023Quote: ... Embedded slides were paraffinized at 72°C with EZ solution (Roche, Ventana) and MECOM antigen was retrieved with CC2 pre-diluted Tris solution for 64 minutes at 91℃ ...
-
bioRxiv - Plant Biology 2024Quote: ... at the annealing temperature of 58 °C on LightCycler480 instrument (Roche, Switzerland). PCR efficiency was estimated using serial dilution of template cDNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 5-bromo4-chloro-3-indolyl phosphate toludinium (Roche Diagnostics, Cat. No 11383221001). Images were taken on a Zeiss Axio Compound Light Microscope with Optronics MacroFire Digital Camera.
-
bioRxiv - Developmental Biology 2021Quote: ... 3 % SDS with protease inhibitors (cOmplete Mini EDTA-free Protease Inhibitor Cocktail, Roche) at room temperature for 1 hour in a total volume of 3 mL ...
-
bioRxiv - Microbiology 2021Quote: ... 3 mM DTT and 1 mM PMSF) supplemented with protease inhibitor cocktail (Roche). Zirconium beads equivalent to 100 µL volume was added in microcentrifuge tubes and resuspended cells were lysed by 6 rounds of bead beating on a bullet blender ...
-
bioRxiv - Cell Biology 2022Quote: ... collected in a 1.5 ml tube and blocked overnight in 3% BSA (Roche) before incubating in primary antibody (3% BSA in PBT ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T?cells using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 188 mg/mL 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in a solution of 0.1 M Tris (pH 9.5) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 with with 2X cOmplete Protease Inhibitor Cocktail EDTA-free (Roche)) for 8 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Mannheim, Germany Cat#11383221001) was used in conjunction with nitro blue tetrazolium (NBT ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted by digesting the RNA with 3 µg RNase A (Roche) and 30U RNase T1 (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.2% bromophenol blue) and treated with 3 mg/ml Proteinase K (Roche) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Each sample was subject to 3 rounds of homogenisation using a MagnaLyser (Roche) at 6,000 rpm for 15 seconds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Poly-guanine was added at the cDNAs 3’ end using Terminal Transferase (Roche) and dGTPs ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3×10−4 M MTG and 300 μg/ml human transferrin (Roche, 10652202001)) in a triple vent petri 10 cm dishes (Thermo fisher ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Cell Biology 2024Quote: ... diluted in PBS containing 3% Bovine Serum Albumin (BSA; Roche Diagnostics, Basel, Switzerland), were applied onto the coverslips and incubated for 1 h at RT ...
-
bioRxiv - Genetics 2020Quote: ... The DIG probe was hybridized to the membrane (at 44°C; using Roche DIG Easy Hyb Granules for hybridization buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... or endoproteinase Glu-C from Staphylococcus aureus V8 (Roche Diagnostics GmbH, Mannheim, Germany). Enzyme to protein ratios were 1:20 ...
-
bioRxiv - Developmental Biology 2022Quote: ... then hybridized overnight at 65 °C with digoxigenin-labeled RNA probes (Roche, 11277073910). The probes were detected with AP coupled with anti-digoxigenin Fab fragments (Roche ...
-
bioRxiv - Systems Biology 2021Quote: Recombinant proteins were purified using the Anti-Protein C Affinity Matrix (11815024001, Roche) on an ASPEC liquid handling instrument (Gilson) ...
-
bioRxiv - Plant Biology 2021Quote: ... and immunolabeled with specific antibodies against anti-c-Myc (1:1000, E910, Roche), anti-GFP (1:10000 ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated for 1 hour at 37°C with 10U DNase (Roche) in R10 medium (RPMI 1640 medium containing GlutaMAX from Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were then blocked overnight at 4°C in 1 % blocking reagent (Roche) plus 5 % sheep serum in MAB and incubated with anti-DIG conjugated to Peroxidase (1/50 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 7.4 at 23°C) supplemented with EDTA-free protease inhibitor cocktail (Roche) at approximately 7 ml per gram of wet weight and subjected to 3 rounds of disruption on a high-pressure homogenizer (Avestin ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins were digested for 18 h at 37°C with chymotrypsin (Roche, Germany), followed by 3 h at 37°C using trypsin (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... Micro-C library was generated by using KAPA HiFi HotStart ReadyMix (Roche #KK2601) or Q5 High-Fidelity 2X Master Mix (NEB #E7645 ...
-
bioRxiv - Molecular Biology 2021Quote: ... digested rotating for 1h at 37°C with 2mg/ml Collagenase/Dispase (Roche) and then filtered twice (100 μm ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... at 37°C for 30 min and 0.1 mg/mL proteinase K (Roche) at 50 °C for 1 hour and were purified with a MinElute PCR Purification Kit (QIAGEN).
-
bioRxiv - Molecular Biology 2023Quote: ... Urine was analyzed for Protein and Albumin (Cobas c 311 Analyzer; Roche Diagnostics).
-
bioRxiv - Systems Biology 2024Quote: ... then 5 min at 62°C) with KAPA HiFi HotStart Ready Mix (Roche). Libraries were quantified by Bioanalyzer (Agilent ...
-
bioRxiv - Developmental Biology 2024Quote: ... then hybridized overnight at 65 °C with digoxigenin-labeled RNA probes (Roche, 11277073910). The probes were detected with AP coupled with anti-digoxigenin Fab fragments (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated at 37°C for 30 minutes in proteinase K solution (Roche Diagnostics ...
-
bioRxiv - Genetics 2024Quote: Ide genotype rs30920120 (C/G) was assayed using LightCycler 480 Instrument II (Roche) or the TaqMan method (Applied Biosystems Inc ...
-
bioRxiv - Immunology 2024Quote: ... then were digested for 20 min at 37 °C with Liberase TM (Roche) plus DNase I (Roche) ...
-
bioRxiv - Systems Biology 2024Quote: ... the pellet was washed with Reagent C supplemented with Protease Inhibitors (11697498001, Roche), and aliquoted for the subsequent characterization ...
-
bioRxiv - Cancer Biology 2024Quote: ... digested 30 min at 37°C in 0.15 mg/mL collagenase D (Roche) and subsequently fixed in 1% paraformaldehyde (PFA ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...