Labshake search
Citations for Roche :
251 - 300 of 3664 citations for mmu mir 212 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time RT-PCR of target genes were performed using KAPA SYBR FAST qPCR kit (KAPA Biosystems). Expression levels were calculated according to the relative 2−ΔΔCt method.14 All primers are listed (Supplemental Table 2S).
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time RT-PCR of target genes were performed using KAPA SYBR FAST qPCR kit (KAPA Biosystems). Expression levels were calculated according to the relative 2-ΔΔCt method.65 All primers for target genes are listed (Supplemental Table 5S).
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was analyzed in triplicate by quantitative RT-PCR with LightCycler 480 SYBR Green I Master mix (Roche) using the Roche LightCycler 480 II instrument ...
-
bioRxiv - Genomics 2020Quote: ... Specimens in May were tested using the Cobas® SARS-CoV-2 RT-PCR assay (Roche Diagnostics, USA). Respiratory samples archived at the Clinical Laboratory ...
-
bioRxiv - Molecular Biology 2023Quote: Real-time RT-PCR were performed with the Roche Lightcycler 480 system (Roche Diagnostics, Neuilly-Sur-Seine, France). The mix of the reaction was 6 μL per sample ...
-
bioRxiv - Physiology 2022Quote: ... Quantitative real-time polymerase chain reaction (RT-PCR) was performed using SYBR Green protocols (Kapa Biosystems, MA, USA) on a real-time PCR detection system (Applied Biosystems 7300 Real-Time PCR system) ...
-
bioRxiv - Cell Biology 2023Quote: ... quantitative PCR (RT-qPCR) with the SensiFAST SYBR No-ROX One-Step Kit in a LightCycler 96 (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative real-time PCR (RT-qPCR) was performed using LightCycler® 480 SYBR Green I Master (Roche, Germany) and Muc5a primers (IDT ...
-
bioRxiv - Genetics 2023Quote: Quantitative RT-PCR was performed in a final volume of 5 μl with SYBR Green I Master (Roche) and analyzed with a Lightcycler 480 (Roche ...
-
bioRxiv - Genetics 2023Quote: ... Real-time RT-PCR analysis was carried out using a LightCycler-® 480 Instrument II (Roche Diagnostics, USA) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primers were designed using the LC Primer/Probe design software (Roche) and ordered from IDT ...
-
bioRxiv - Biochemistry 2022Quote: ... RT buffer (Roche) and Reverse Transcriptase (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of PCR gene specific primer (10X conc) (Table S1) and 10 μl of master mix (Roche 04707516001) in 20 μl reaction ...
-
bioRxiv - Genomics 2020Quote: ... primers listed in Supplementary Table 6 were used to perform two consecutive PCR reactions with KAPA HiFi polymerase (Roche). Starting from 100 ng of library plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was amplified using gene specific primers and the LightCycler 480 SYBR Green PCR Master Mix (Roche, Basel, Switzerland) on Lightcycler 480 instrument (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was diluted 1:5 in PCR-grade dH2O and 1.5 µl of the cDNA-mix was used per 20 µl real-time PCR reaction with 0.25 µM of each primer and 2 x FastStart Essential DNA Green Master Mix (Roche). For each target and reference gene ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Genomics 2020Quote: ... DNA on the beads was PCR amplified with barcoded primers using KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) for 5~12 PCR cycles to obtain enough DNA for sequencing ...
-
bioRxiv - Genomics 2022Quote: ... The final PCR reaction included 1.11uM N7XX and primers (384PP_AQBP) in 2X HiFi HotStart Ready Mix (Roche# KK2602, 6RES_GPSA) as previously described6 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µl of cDNA were used for Real-Time PCR with self-designed primers and SYBR green reaction (Roche). qRT-PCR reactions were performed in duplicates including non-template controls on a QuantStudio 3 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transgenes were identified using PCR primers specific for each transgene (Suppl. Table 2) amplified using Taq DNA polymerase (Roche) and Failsafe Buffer D (Epicentre) ...
-
bioRxiv - Microbiology 2024Quote: ... six reverse primers (10 μM) and Robust DNA polymerase from the KAPA2G Robust PCR Kit (Kapa Biosystems, Wilmington, MA). Cycling conditions were ...
-
bioRxiv - Cancer Biology 2024Quote: qRT-PCR was performed in triplicates in 384-well plates using primers and Roche universal probe library (Roche, 04869877001) with TaqManTM Universal MasterMix II (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... Diluted extracts were amplified in 12 parallel reactions using the Transcriptor One-step RT-PCR kit (Roche, Basel, Switzerland) for reverse-transcription and first-round PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... and quantitative RT-PCR for library quantification was performed using the Kapa Library Quantification Kit (Roche Sequencing, Pleasanton, CA). The libraries were sequenced on the Illumina NextSeq 500 v2 sequencer with a 75-base paired-end run in order to generate about 40 million read pairs per sample.
-
bioRxiv - Molecular Biology 2021Quote: RT-qPCR were performed using the high-throughput Light Cycler 480 II Real-Time PCR system (Roche, Germany, Mannheim). In order to determine the genes expression levels of total RNA samples obtained from patient and control groups ...
-
bioRxiv - Immunology 2020Quote: DNase treatment was performed prior to Reverse transcription polymerase chain reaction (RT-PCR) using RNAse-free DNase I (Roche) at 37°C for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: Real-time RT-PCR was performed as previously described with Fast-Start Universal SYBR Green Master (Roche Applied Science) (35 ...
-
bioRxiv - Physiology 2023Quote: ... and quantitative real-time polymerase chain reaction (RT-PCR) was performed with SYBR Green protocols (Kapa Biosystems, MA, USA) and a real-time PCR detection system (Applied Biosystems 7300 Real-Time PCR system).29,30 Target gene expression was normalized to a housekeeping gene (ribosomal protein S18 ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using a One-step BrightGreen RT-qPCR Kit (Abm, G471-S) following the manufacturer’s protocol in the LightCycler 96 Real-Time PCR System (Roche). Isocitrate dehydrogenase (ICDH ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-PCR analysis was performed using the FastStart Essential DNA Green Master mix and LightCycler 96 (Roche Applied Science). Relative transcript levels were determined by normalizing with PP2A (At1g13320 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Random primers (Roche). Quantitative PCRs were performed using mouse-specific TaqMan primers and probes (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... and random primers (Roche). Then we evaluated the gene expression levels using TaqMan Gene Expression Assays for Casp3 (TaqMan® Gene Expression Assays cat#00563962 ...
-
bioRxiv - Cell Biology 2020Quote: ... Target regions were amplified by using specific PCR primers (ETV2_F: CACTCGGGATCCGTTACTCC; ETV2_R: GTTCGGAGCAAACGGTGAGA, KDR_F: CAAGCCCTTTGTTGTACTCAATTCT; KDR_R: ATTAATTTTTCAGGGGACAGAGGGA) and KAPA HiFi HotStart PCR kit (KAPA Biosystems, Cat No. KK2601). Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was performed with the specific primers listed in Table 2 using the LightCycler 480 (Roche, Manheim, Germany).
-
bioRxiv - Systems Biology 2020Quote: ... and per sample eight PCR reactions with 4,000 beads each in 50µl using 1µM SMART PCR primer (oligos in supplementary table 5) and the 2x Kapa HiFi Hotstart Ready mix (Roche #07958935001) were performed ...
-
bioRxiv - Bioengineering 2021Quote: Biotin-labeled dsDNA template was first amplified from the plasmid encoding the template design with biotin-labeled primers using KAPA HiFi HotStart ReadyMix PCR Kit (Roche) for 35 cycles (98°C for 20 s ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... DIG and FITC labeled RNA probes were generated using PCR incorporating T7 promoters in the primers and ultimately transcribed with T7 polymerase (Roche). Forward and Reverse primer sequences are listed in Supplemental Table 1 ...
-
bioRxiv - Genomics 2019Quote: ... and cleaned-up before PCR amplification with multiplexing primers and uracil-tolerant Taq polymerase (KAPA HiFi Uracil+ (Roche Cat. KK2801)) ...
-
bioRxiv - Immunology 2021Quote: ... 2.5µL diluted cDNA was used as template in a 10µL qRT-PCR reaction performed in duplicate using gene-specific primers and Kapa SYBR Green Universal qPCR mix (KAPA Biosystems) according to manufacturer’s instructions using a BioRad CFX Connect Real-Time PCR System ...
-
bioRxiv - Cancer Biology 2019Quote: Real-time PCR analysis of cDNA samples was performed with specific primers and probes designed by using Assay Design Center (Roche). Primers and probes used here are available upon request ...
-
bioRxiv - Genetics 2021Quote: ... The PCR was performed with single sense (negative control) or antisense primers in presence of DIG-labelled deoxynucleoside triphosphates (dNTPs) (Roche). Freshly hatched J2s were fixed and hybridized with the probes following the protocol of de Boer et al ...
-
bioRxiv - Physiology 2021Quote: ... gDNA regions were amplified via PCR using 1/150th gDNA and 300nM forward and reverse primers in a 50 μL FastStart PCR Master Mix reaction (Roche). PCR products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse transcribed with qScript cDNA SuperMix (Quanta Biosciences) and primer-specific amplified with the quantitative PCR MasterMix FastStart Universal SYBR Green (Roche) or the TaqMan® Universal Master Mix II when using the Universal Probe Library (Roche) ...
-
bioRxiv - Microbiology 2021Quote: Wildtype genes were amplified by PCR from JE2 genomic DNA using the primers shown in table 4 and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using KpnI and SacI restriction sites and T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... the V4 region of the 16S rRNA gene was amplified with barcode primers containing the index sequences using a KAPA HiFi HotStart Real-time PCR Master Mix (Roche). We monitored PCR product amplification and concentration on a Bio-Rad CFT Connect Real-Time PCR system ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR was performed with 500 nM of oligo U1 and U2 primer in 2x KAPA HiFi HotStart Uracil+ ReadyMix (Roche) in 50 μl ...