Labshake search
Citations for Roche :
251 - 300 of 5389 citations for QuantiChrom Magnesium Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The qPCR assays were carried out in a LightCycler96 system (Roche), using MESA BLUE qPCR kit for SYBR assay (Eurogentec ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed using Sybr green-based assay (Roche, Indiana, USA) using IDT primers (IDT technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... performed according to the manufacturer’s instructions (Roche - TeloTAGGG telomere length assay). The protocol involved DNA fragmentation using a combination of the frequently cutting restriction enzymes Hinf1 and Rsa1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... TaqMan assays and Universal Probe Library (UPL) probes (Roche Molecular Systems) were used to perform gene quantification.
-
bioRxiv - Immunology 2021Quote: ... Assays were performed with Kapa SYBR Fast qPCR master mix (Roche) and mRNA expression levels of Crtc2 and Prdm1 were quantified with standard curves and results were normalized to the expression of Rps18 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 μl of 2X kinase assay buffer containing 40μM ATP (Roche) was added to the tubes and 10μg equivalent of corresponding lysate was added ...
-
bioRxiv - Cell Biology 2021Quote: C2C12 cell proliferation was measured using the WST1 colorimetric assay (Roche). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... Cytotoxicity of the compounds was assessed using the MTT assay (Roche) in uninfected cells treated with the same compound dilution and concurrent with the viral replication assay.
-
bioRxiv - Cell Biology 2022Quote: ... gene expression assays on a Roche Lightcycler 480 (Roche, Basel, Switzerland) using standard protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Assays were done using a LightCycler® 480 (Roche Applied Science) and the following conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... qPCR was performed using Sybr green-based assay (Roche, Indiana, USA) using IDT primers (IDT technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... qRT-PCR assays were performed on the LightCycler 480 System (Roche).
-
bioRxiv - Cell Biology 2020Quote: WST-1 assay was employed to measure proliferation rates (Roche, Switzerland). Cells were seeded at a density of 1000 cells per well in 96-well plates one day prior to transfection ...
-
bioRxiv - Microbiology 2022Quote: ... This assay was performed on a LightCycler 480 (Roche, Basel, Switzerland).
-
bioRxiv - Microbiology 2022Quote: ... and qPCR assays were carried out in a LightCycler96 system (Roche), using MESA BLUE qPCR kit for SYBR assay (Eurogentec ...
-
bioRxiv - Microbiology 2022Quote: ... HBeAg was detected using the Elecsys HBeAg assay (Roche, Meylan, France). Lumipulse® G HBcrAg assay (Fujirebio ...
-
bioRxiv - Molecular Biology 2022Quote: ... ATP concentration was determined by ATP bioluminescence assay (Roche, Tucson, AZ) following the manufacturers’ instructions ...
-
bioRxiv - Immunology 2023Quote: ... glucose were measured by automated enzymatic colorimetric assay (Cobas, Roche, Germany). The area under the curve (AUC ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the Luciferase Reporter Gene Assay according to manufacturer’s instructions (Roche). Hep3B cells were stimulated with human IL-6 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Immunology 2024Quote: ... using an immunoturbidimetric assay on the Cobas 6000 analyzer (Roche Diagnostics). The lowest level of detection was 0.2 mg/L ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Glycogen assays (Pointe Scientific G7521-500, Roche 10102857001, Thermo Sci J16445-06), triglyceride assays (Pointe Scientific T7532-120 ...
-
bioRxiv - Cancer Biology 2020Quote: Cell viability was evaluated using the colorimetric WST-1 assay (Roche Diagnostics). After a 4-h incubation period with WST-1 reagent the absorbance was measured at 450 nm/ 600 nm using a microplate reader (ELISA-Reader Zenyth 200st ...
-
bioRxiv - Cancer Biology 2020Quote: ... Q-PCR was performed with SYBR green-based gene expression assays (Roche). Primer sequences are available on request.
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Centre (Roche), compatible with UPLs 157 (ActB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... And then qPCR assays were performed on the LightCycler 480 II (Roche) in 10μL reaction volume containing 6μL of SYBR green Master mix (Fisher Scientific A25918) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was measured by WST-1 assay following manufacture’s protocol (Roche). The IC50 and CC50 were calculated using a four-parameter logistic regression model from the GraphPad Prism 5 software (GraphPad Software Inc.).
-
bioRxiv - Bioengineering 2021Quote: Primers were designed using the Universal Probe Library Assay Design Center (Roche) and checked for specificity against the Physcomitrella transcriptome in the Phytozome database (Goodstein et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The assay was followed according to the manufacturers protocol (Roche Applied Science).
-
bioRxiv - Cell Biology 2021Quote: ... Te assay was performed according to the instructions of the vendor (Roche). The population doubling time was computed as the ln(2)/slope of the proliferation growth curve using Prism software ...
-
bioRxiv - Biochemistry 2022Quote: ... TUNEL assay was carried out according to manufacturers instructions (Roche Diagnostics, IN). Primary antibodies were visualized with species-specific secondary antibodies conjugated to fluorescent probes ...
-
bioRxiv - Biophysics 2022Quote: ... Cytotoxicity was also performed at matched concentrations using the MTT assay (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Center (Roche). Quantitative PCR was carried out using a LightCycler 96 (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... All qPCR assays were carried out on a LightCycler 480 (Roche Diagnostics) using the LightCycler 480 software version 1.5.1.
-
bioRxiv - Immunology 2023Quote: ... The qPCR assays were done with FastStart Essential DNA Green Master (Roche) with the primers are listed in supplementary methods.
-
bioRxiv - Microbiology 2023Quote: ... qPCR assays were performed with a Light Cycler 480 II instrument (Roche), using the Maxima TM SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Cell Biology 2024Quote: ... WST-1 assays to measure cell proliferation rate (Roche Cat. No. 5015944001) were conducted using the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2021Quote: ... cells were centrifuged and cell killing assessed using the LDH Assay (Roche #11644793001) according to the manufacturers protocol using the SPECTROstar Nano (BMG Labtech).
-
bioRxiv - Genetics 2020Quote: ... Relative qPCR assays were performed using the LightCycler 480 qPCR system from Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2021Quote: ... The proliferation assay was carried out following the manufacturer’s instructions (Roche, Indianapolis, IN) at 24 and 72 hours ...
-
bioRxiv - Immunology 2019Quote: ... Libraries were checked for quality control with KAPA qPCR QC assay (KAPA Biosystems). The libraries (33 total ...
-
bioRxiv - Genomics 2019Quote: ... The library was quantified using a real-time qPCR assay (Lightcycler 480 Roche) with the universal Illumina adapter sequences IS7 and IS8 as targets ...
-
bioRxiv - Physiology 2019Quote: ... Normalized SIRT1 amount was used for activity assays using calf thymus histones (Roche), as indicated below.
-
bioRxiv - Cancer Biology 2021Quote: The thermal stability assay was performed in the Real Time Detection system (Roche). Each pMHC complex was diluted in 10 mM Tris-HCl (pH 8.0) ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... cellular proliferation was evaluated using a WST-1 assay (05015944001, Roche, Basel, Switzerland). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR assays were carried out on LightCycler LC480 II (Roche Diagnostics, Germany) using SYBR Green Jumpstart Taq Ready mix (Sigma-Aldrich ...
-
bioRxiv - Immunology 2019Quote: ... assays were performed in the presence of 1000 U/mL IL-2 (Roche). Effector-target conjugates were incubated in 200 mL in round-bottom 96-well plates (Corning ...
-
bioRxiv - Pathology 2020Quote: ... Glucose (mmol/L) in serum was measured using the GLUC2 assay from Roche, an enzymatic reference method with hexokinase ...
-
bioRxiv - Pathology 2020Quote: ... Insulin (mU/L) in serum was measured using the INSULIN assay from Roche, a sandwich electrochemiluminescence immunoassay ECLIA on Cobas e 411 (Roche ...