Labshake search
Citations for Roche :
251 - 300 of 1100 citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 0.5% BSA and 3 mg/mL DNAse I grade II (Roche, Cat# 104159). Once resuspended ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM TCEP) containing 1 tablet of complete EDTA-free protease inhibitor cocktail (Roche) and PhosSTOP (PHOSS-RO Roche ...
-
bioRxiv - Immunology 2024Quote: ... lungs harvested in HEPES buffer containing Liberase Blendzyme 3 (70 μg/mL; Roche, #05401020001) and DNaseI (30 μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by 1-3 days in an NBT/BCIP (Roche, Cat No./ID: 11681451001) solution ...
-
bioRxiv - Physiology 2024Quote: ... and 5- nitro blue tetrazolium/bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) (Roche) as chromogenic substrates ...
-
bioRxiv - Developmental Biology 2021Quote: ... Whole brain lysate was precleared with Protein G agarose (Roche, 11243233001) and the supernatant was immunoprecipitated with CB1R antibody overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... The lysate was pre-cleared with protein G-agarose beads (Roche) and incubated with anti-FLAG M2 agarose beads (Sigma #A2220) ...
-
bioRxiv - Molecular Biology 2020Quote: ... HA-tagged proteins were detected with mouse (Covance) or rat (Roche) monoclonal anti-V5 antibodies at 1 μg/ml or 12.5 ng/ml respectively ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatants were incubated and rotated with Protein A beads (Roche) with an anti-Mcm2 antibody (Bethyl ...
-
bioRxiv - Plant Biology 2020Quote: ... protein blotting was performed using antibodies against GFP (Roche, Basel, Switzerland) and HA (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... HA-tagged proteins were detected with Anti-HA-Peroxidase (Roche #12013819001) at a dilution of 1:5,000 ...
-
bioRxiv - Microbiology 2021Quote: ... and pre-cleared with 80 μL of Protein-A agarose (Roche) and 100 μg BSA ...
-
bioRxiv - Microbiology 2022Quote: ... To prevent protein degradation a protease inhibitor was added (Complete, Roche). Afterwards ...
-
bioRxiv - Immunology 2020Quote: ... urinary protein level using a P800 biochemical analyzer (Roche, Mannheim, Germany), and urinary RBC and white blood cell (WBC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protease inhibitor cocktail and protein phosphatase inhibitor cocktail were from Roche. MS023 (SML1555) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by incubation with 20 μl of protein G-beads (Roche) for 1 h on a rotator at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... protein was extracted with EB2 supplemented with PhosStop (Roche, Indianapolis, IN) and were subjected to IP with 15 μl of settled a-FLAG beads (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal mouse antibodies were used to detect GFP-tagged proteins (Roche) (dilution 1:2000 ...
-
bioRxiv - Pathology 2023Quote: ... The expressed proteins were detected by using anti-HA-HRP (Roche) at a dilution of 1:5,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were visualized using Lumi-Light Western Blotting Substrate (Roche, Switzerland). The signal was detected using the ChemiDOC MP Imaging System (Bio-rad ...
-
bioRxiv - Immunology 2022Quote: ... containing phosphoSTOP and protein inhibitors cocktail (100 mg/ml, Roche 11836153001) was added to the tube at the ratio of 1 ml buffer per 100 mg tissue ...
-
bioRxiv - Plant Biology 2023Quote: ... A volume containing 50 ul of Protein A - agarose beads (Roche) was then added to the extract before overnight incubation ...
-
bioRxiv - Microbiology 2023Quote: ... The target protein was purified using His-Tag Purification Resin (Roche) according to the manufacturer instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... Antibody-chromatin complexes were recovered using protein G-agarose beads (Roche). After washing ...
-
bioRxiv - Biochemistry 2023Quote: ... FLAG-tagged proteins were detected with a mouse anti-FLAG (Roche) antibody diluted 1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein visualization was performed by chemiluminescence using LumiLight western blotting (Roche) and ImageQuant 800 (GE Healthcare) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mM PMFS (Thermo Fischer) and 1x protein inhibitor cocktail (Roche). Extracts were immediately subjected to SDS PAGE or frozen at -20°C until needed.
-
bioRxiv - Microbiology 2024Quote: ... and Myc tagged proteins were detected using anti- GFP (Roche: 11814460001), anti-Fur ...
-
bioRxiv - Genetics 2024Quote: ... Protein was extracted with ELB buffer described above plus PhosSTOP (Roche) and 50 μM sodium fluoride ...
-
bioRxiv - Plant Biology 2024Quote: ... and 200 µL of protein A agarose beads (Roche, Ref: 11719408001) were added to the remaining supernatant and incubated for 2 h at 4°C on a rotation wheel ...