Labshake search
Citations for Roche :
251 - 300 of 2678 citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... The sample was incubated for 2 h with 2 μl of 20 mg/ml ProteinasK (Roche), and subjected to AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were blocked in 2% TNB (2% blocking reagent (Roche, REF 11 096 176 001) in TNT for 2-3 h at room temperature and incubated with an anti-Fluo-POD antibody (1/50 ...
-
bioRxiv - Microbiology 2024Quote: ... interleukin-2 (IL-2; specific activity 10 U/ng) at concentration of 20 ng/mL (Roche) and phytohemagglutinin (PHA ...
-
bioRxiv - Immunology 2023Quote: ... the medium was supplemented with 30 IU/mL recombinant human interleukin 2 (IL-2) (Proleukin, Roche). Electroporated T cells were kept in culture ON and then used directly or frozen.
-
bioRxiv - Genomics 2024Quote: ... with 2% BSA and resuspended in NEB+ (NEB with 2% BSA, 1U/ml proteinase inhibitor Roche #3335402001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... dry milk or 2% BSA (Roche), membranes were probed with primary antibody (dilution 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% BSA fraction V (Roche Diagnostics), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Immunology 2021Quote: ... 2 mg/mL Collagenase VIII (Roche) and 0.5 mg/mL DNAse I (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 pg of E.coli rRNA (Roche) was added as spike-in to equal volumes of RNA extracted from sucrose gradient fractions for the reverse transcription ...
-
bioRxiv - Bioengineering 2021Quote: ... and 30U/ml hIL-2 (Roche). After 2 days ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of DNase I (Roche), and 1 μl of RNase OUT (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... 2 mg/ml collagenase D (Roche), and 1.5 mg/ml DNase I (Roche ...
-
bioRxiv - Biophysics 2021Quote: ... 2 μg ml−1 DNaseI (Roche), and protease inhibitor cocktail (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL] ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 protease inhibitor cocktail tablets (Roche) per 100 mL solution] at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... we used 2% Blocking Reagent (Roche) in PBS with 0.1% Tween-20 ...
-
bioRxiv - Immunology 2020Quote: ... + 2 U/mL DNAse I (Roche), shaking at 200 rpm for 45 mins – 1 hour at 37 °C ...
-
The transcription factor RUNX2 drives the generation of human NK cells and promotes tissue residencybioRxiv - Immunology 2022Quote: ... collagenase D (2 mg/mL, Roche) and Dnase I (0.2 mg/mL ...
-
bioRxiv - Developmental Biology 2020Quote: ... in 2% blocking solution (Roche 11096176001) were used for RNA probe detection ...
-
bioRxiv - Immunology 2021Quote: ... 2 mg/mL collagenase A (Roche), and 2 mg/mL collagenase D (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... IL-2 (50 IU/ml) (Roche) and glucose (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2× complete protease inhibitor cocktail (Roche, Sigma/Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μg of DNase I (Roche) treated RNA was converted to cDNA using BioScript Reverse Transcriptase (Bioline ...
-
bioRxiv - Immunology 2022Quote: ... 2 mg/mL Collagenase VIII (Roche) and 0.5 mg/mL DNAse I (Roche ...
-
bioRxiv - Genetics 2023Quote: ... and 2% protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 “Complete” protease inhibitor tablets (Roche), 25 μg/mL lysozyme (Gold Biochem ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2% pronase (Roche, Basel, Switzerland). Cells were passed through a 70 μm cell strainer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... 2 cOmplete Protease Inhibitor tablets (Roche)) ...
-
Decreased Astrocytic CCL5 by MiR-324-5p Ameliorates Ischemic Stroke Injury via CCR5/ERK/CREB PathwaybioRxiv - Neuroscience 2024Quote: ... 2 μg/μl CCL5 antibody (Roche), or 20 ng/μl recombinant mouse CCL5 (Absin) ...
-
bioRxiv - Immunology 2024Quote: ... Liberase TL (2 U/ml; Roche) and DNAse1 (160 U/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... #2 and #ref were from Roche.
-
bioRxiv - Neuroscience 2024Quote: ... 2× HotStart Ready Mix (Roche, KK2601) was used for PCR amplification ...
-
bioRxiv - Cell Biology 2024Quote: ... 2×cOmplete Protease Inhibitor Cocktail (Roche), and 1% n-dodecyl-β-maltoside (DDM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 7.5, 150 mM NaCl, 5% glycerol, 1% Triton X-100, 1□mM EDTA, 1X Complete Mini protease inhibitor cocktail [Roche]). Tissues were disrupted using a mechanical homogenizer (IKA T10 basic ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mM KCl, 10mM MgCl2, 1 mM PMSF, 5 mM Na3VO4, 5 mM NaF, 1 mM TCEP, cOmplete Protease Inhibitor Cocktail, Roche) in 2 steps ...
-
bioRxiv - Molecular Biology 2022Quote: ... blots were hybridized with 10 pmol/ml DIG-labeled (CAG)7 (5′-gcAgCagcAgca-3′) at 70°C for 4 h in hybridization buffer (5 × SSC, 1% block solution [Roche, Switzerland] ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 –1 L of the crude lysates were treated with 5 mg/mL each of DNase I and RNAse (Roche) for one hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... 5% d8-13C depleted glycerol, 1 mM EDTA, 5 ug/mL of aprotinin and leupeptin and 100 µg/mL Roche protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were fixed with 2% paraformaldehyde/ 2% sucrose for 20 min and stained with DAPI (#10236276001, Roche) to visualize anaphases ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% FBS and 0.1% Insulin-transferrin-selenium (Roche)[14] ...