Labshake search
Citations for Roche :
251 - 300 of 984 citations for 3 4 Dehydro Cilostazol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Signals were developed using 4-nitro blue tetrazolium chloride (NBT, Roche) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.25% Triton supplemented with protease inhibitor at 4□°C (Roche, 04693159001) for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 mM MgSO4) containing Complete Inhibitor Protease Cocktail (Roche, Indianapolis, IN), lysozyme and DNAse ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C overnight and subsequently developed with NBT/BCIP (Roche). For FISH ...
-
bioRxiv - Neuroscience 2020Quote: ... at 4°C with alkaline phosphate anti-DIG (1:2000, Roche). For chromogenic revelation ...
-
bioRxiv - Physiology 2020Quote: ... containing 0.2 mg 4-(2-aminoethyl)-benzene-sulfonyl fluoride (AEBSF, Roche). Serum from blood samples was obtained by centrifugation at 3,000 rpm for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 complete-EDTA protease-inhibitor tablets per 500 mL (Roche). After thawing ...
-
bioRxiv - Immunology 2022Quote: ... nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Roche) for 4 min at room temperature and observed them under a Laserscaing Confocal Microscopy (TCS SP8 STED ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA (4 ng) and LightCycler 480 SYBR Green I Master (Roche) in a final volume of 10 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... or 1µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche).
-
bioRxiv - Neuroscience 2023Quote: ... 4% BlockAce (DS Pharma Biomedical) and 0.5× Blocking reagent (Roche Diagnostics)] for 1 hr at RT ...
-
bioRxiv - Immunology 2023Quote: ... samples were counterstained with 4’,6-Diamidino-2-phenylindol (DAPI, Roche).
-
bioRxiv - Cancer Biology 2023Quote: ... Immunohistochemistry was performed on 4 μm sections using the BenchmarkUltra (Roche), anti-hCD45 (M0701 ...
-
bioRxiv - Plant Biology 2023Quote: ... 1/200 mM NaF) containing 4 tablets of protease inhibitor (Roche cOmplete ...
-
bioRxiv - Neuroscience 2024Quote: ... and detection with 4-Nitro blue tetrazolium chloride (NBT; 11383213001, Roche) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1-3 ng of ChIP DNA with KAPA Library Preparation Kit (KAPA Biosystems) and NimbleGen SeqCap Adaptor Kit A or B (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Developmental Biology 2019Quote: ... then incubated overnight at 4°C with anti-DIG antibody (Roche #11093274910) at 1:5000 in block ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 4 μL of 500 ug/ml RNase (Roche, Cat. No 11119915001) was added and incubated for 1 h at 37° C to digest RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and visualized by staining with 4-nitro blue tetrazolium (NBT, #11383213001, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Neuroscience 2020Quote: Animals were perfused and post-fixed overnight using 4% paraformaldehyde (HistoFix, Roche). Vibratome sections (100-200 μm ...
-
bioRxiv - Immunology 2021Quote: ... Live/dead cell exclusion was performed with DAPI (4′-phenylindole dihydrochloride; Roche) or LIVE/dead fixable dye (Thermofisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and incubated with 4 μl of DIG-Prime kit (Roche, Mannheim, Germany), overnight at 37°C ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... overnight at 4 °C in presence of protease inhibitor cocktail (Roche, Switzerland). The beads were washed with buffer W ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 mM DTT) supplemented with 2x Complete EDTA free protease inhibitor (Roche). Samples were spun at 30,000 g for 10 min at 4°C and the cleared lysate was incubated with 40 µl anti-FLAG agarose bead slurry (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... proteinase K (4 µg/ml; F. Hoffmann La Roche Ltd, 211 Switzerland) and by heating at 96°C for 20 min in EnVisionTM FLEX Target Retrieval solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... were incorporated by PCR (4 cycles) using KAPA HiFi Hotstart ReadyMix (Roche).
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with 4’,6-Diamidine-2’-phenylindole-dihydrochloride (DAPI; Roche).
-
bioRxiv - Genomics 2023Quote: ... 4 μL of Lysis mix (Proteinase K (5.05 mg/mL, Roche, 3115879001), IGEPAL CA-630 (5.05% ...
-
bioRxiv - Microbiology 2023Quote: ... 250 μL lysis buffer (4% w/v SDS and cOmplete Tablets (Roche) in 50 mM Tris-HCl ...