Labshake search
Citations for Roche :
251 - 300 of 3016 citations for 3' 5' Dimethyl 3 2 3 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... 3 % SDS with protease inhibitors (cOmplete Mini EDTA-free Protease Inhibitor Cocktail, Roche) at room temperature for 1 hour in a total volume of 3 mL ...
-
bioRxiv - Microbiology 2021Quote: ... 3 mM DTT and 1 mM PMSF) supplemented with protease inhibitor cocktail (Roche). Zirconium beads equivalent to 100 µL volume was added in microcentrifuge tubes and resuspended cells were lysed by 6 rounds of bead beating on a bullet blender ...
-
bioRxiv - Cell Biology 2022Quote: ... collected in a 1.5 ml tube and blocked overnight in 3% BSA (Roche) before incubating in primary antibody (3% BSA in PBT ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T?cells using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 with with 2X cOmplete Protease Inhibitor Cocktail EDTA-free (Roche)) for 8 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted by digesting the RNA with 3 µg RNase A (Roche) and 30U RNase T1 (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.2% bromophenol blue) and treated with 3 mg/ml Proteinase K (Roche) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Each sample was subject to 3 rounds of homogenisation using a MagnaLyser (Roche) at 6,000 rpm for 15 seconds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Poly-guanine was added at the cDNAs 3’ end using Terminal Transferase (Roche) and dGTPs ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3×10−4 M MTG and 300 μg/ml human transferrin (Roche, 10652202001)) in a triple vent petri 10 cm dishes (Thermo fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... diluted in PBS containing 3% Bovine Serum Albumin (BSA; Roche Diagnostics, Basel, Switzerland), were applied onto the coverslips and incubated for 1 h at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by 1-3 days in an NBT/BCIP (Roche, Cat No./ID: 11681451001) solution ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 0.5% BSA and 3 mg/mL DNAse I grade II (Roche, Cat# 104159). Once resuspended ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM TCEP) containing 1 tablet of complete EDTA-free protease inhibitor cocktail (Roche) and PhosSTOP (PHOSS-RO Roche ...
-
bioRxiv - Pathology 2024Quote: ... washed 3 times with 1 ml of PBS containing protein inhibitors (Complete, Roche, Basel) and then manually homogenized in 250 µl of Tris EDTA buffer (20 mM Tris ...
-
bioRxiv - Immunology 2024Quote: ... lungs harvested in HEPES buffer containing Liberase Blendzyme 3 (70 μg/mL; Roche, #05401020001) and DNaseI (30 μg/ml ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...