Labshake search
Citations for Roche :
2801 - 2850 of 9754 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 0.2% Triton X-100) with a protease inhibitor cocktail (Roche, no. 04693132001). The lysate was pelleted at 30,000g for 20 min at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... scraped into 100 μl of PBS containing protease inhibitors (Roche, Laval, QC), then transferred to a microcentrifuge tube containing 50 μl of 3X SDS-PAGE loading buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1% Triton X-100) containing cOmpleteTM EDTA-free Protease Inhibitor Cocktail (Roche) and RNase Inhibitor (0.25 U/µl ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.02% TritonX-100 (v/v) and complete protease inhibitor cocktail tablets (Roche) were mixed into the lysate ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 100 ng RNA per sample on a LightCycler 96 instrument (Roche). PCR primers for Rpl8 and Ifna4 were used as given above together with the universal probe library probes (UPL ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM NaCl) supplemented with complete protease inhibitor cocktail tablets (Roche #04693159001) and 10 mg lysozyme for GST fusion proteins or in maltose column buffer (20 mM Tris-HCl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... each containing 100 ng of cDNA in a LightCycler 480 (Roche Diagnostics). The expression level was measured by the RQ ratio in relation to the endogenous ribosomal gene 49 (rp49) ...
-
bioRxiv - Cell Biology 2023Quote: ... cytospins and membranes were permeabilized by 0.1% Triton X-100 (Roche, SIG10789704001) for 15 min and blocked with 2% BSA in PBS for 1 hour at room temperature (RT) ...
-
bioRxiv - Cell Biology 2023Quote: ... Neurons were lysed in 2% Triton X-100 containing protease inhibitors (Roche). A BCA assay (Pierce ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1% Triton X-100) containing a protease inhibitor cocktail (#11836145001, Roche, Switzerland) and phosphatase inhibitors (#04906837001 ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1% Triton X-100) supplemented with cOmplete™ Protease Inhibitor Cocktail (Roche) and 50 μg/ml of RNase A ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.1% Triton X-100) containing fresh protease inhibitor cocktail (Roche, #4693159001) and phosSTOP (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5% sodium deoxycholate 0.5% Triton X-100) with protease inhibitor (Roche, 11836170001). Protein quantification was done by Pierce BCA protein assay following manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... supplemented with 0.5% Triton X-100 and protease inhibitors (Complete Ultra, Roche). Lysates were incubated for 30 minutes at 4 °C ...
-
bioRxiv - Physiology 2024Quote: ... 0.1 % Triton X-100) and 1x protease inhibitor cocktail (Roche, catalog #11697498001) and incubated on ice for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... Triton X-100 0.5% (v/v) with complete antiprotease mix (Roche #11836145001)] ...
-
bioRxiv - Cell Biology 2021Quote: ... and then with 15-20 ml of 37 °C EBS containing collagenase D (0.1 U/ml) (Roche). Damaged livers (48h-72h after APAP injection ...
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Immunology 2020Quote: ... placed in 10 mL of pre-warmed RPMI + 10% FBS + 1.5 mg/mL Collagenase D (Roche 11088866001) + 0.05 mg/mL Collagenase V (Sigma C9263 ...
-
bioRxiv - Genetics 2020Quote: ... 5 μL of glycogen (20 mg/ ml) and 5 μl of proteinase K (20 mg/ ml; Roche) were added to the samples and incubated at 37 °C for 2 hours ...
-
bioRxiv - Immunology 2021Quote: ... Brain was mechanically and enzymatically digested in collagenase/dispase (1mg/mL) and DNase (10mg/mL; Roche Diagnostics). Lung tissue was mechanically and enzymatically digested with Collagenase/Hyaluronidase (3000U and 1000U ...
-
bioRxiv - Cell Biology 2021Quote: ... and digested in Han s’ balanced salt solution containing 0.18 units/mL collagenase (10 mg/mL; Roche) for 45min at 37°C ...
-
bioRxiv - Genetics 2019Quote: ... DMEM was aspirated and replaced with 20 mL DMEM containing 0.5 mg/mL Liberase TM (Roche, 5401127001) and incubated at 32°C for 15 min at 500 rpm ...
-
bioRxiv - Physiology 2022Quote: Islets were isolated by injecting 2 mL collagenaseP (0.8 mg/mL in HBSS, Roche Diagnostics, Catalog # 11249002001) into the bile duct with the ampulla of Vater clamped ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 g of tissue were digested by dispase/collagenase (Collagenase: 0.1U/mL, Dispase: 0.8U/mL, Roche) for 1 hour at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... plus 2% fetal calf serum (Dutscher)) supplemented with 50μg/mL DNAse and 10μg/mL collagenase D (Roche).
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Immunology 2021Quote: Single cells were sorted directly into PCR tubes containing 25 μl PCR lysis buffer (1x Buffer 1 from the Expand Long Template PCR System [Roche], 0.5 mg/ml Proteinase K) and lysed for 1h at 55°C ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Cell Biology 2022Quote: A teratoma was cut into smallest possible pieces and dissociated for 1 hour at +37C in a collagenase A solution (Roche, 0.1 mg/ml in DMEM). The resulting cell suspension was passed through mesh strainers with pore diameter from 100 μm to 40 μm ...
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels were subsequently placed in Eppendorf tubes containing 0.2 mL DPBS for hydrolysis or 0.02 mg/mL bacterial (Clostridium histolyticum) collagenase (Collagenase B, Roche) in 0.2 mL DPBS for enzymolysis ...
-
bioRxiv - Immunology 2022Quote: ... cut in small pieces and digested in PBS supplemented with 0.2 mg/ml Collagenase P and 0.1mg/mL DNase I (both from Roche) for 20 min at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... digested with 0.1 mg/ml Liberase TL in the presence of 0.1 mg/ml DNase (Roche, Meylan, France) and incubated for 30 min at 37°C in 5% of CO2 incubator ...
-
Tracking of quiescence in Leishmania by quantifying the expression of GFP in the ribosomal DNA locusbioRxiv - Microbiology 2019Quote: ... The pieces were placed in 1.0 ml of complete M199 containing 200 μg/ml of Liberase TL (Roche) and incubated at 34 °C for 30 min ...
-
The heterogeneity of the DNA damage response landscape determines patient outcomes in ovarian cancerbioRxiv - Cell Biology 2021Quote: ... Acellular and calcified structures in solid specimens were excised and specimens were incubated with ≥0.1U/ml Collagenase and 0.8U/ml Dispase (Roche) for 120 minutes at 37°C 5% CO2 as per manufacturer’s recommendations ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... infused with digestion buffer (RPMI 1640 [Sigma], Liberase TL [0.1 mg/mL; Roche], and DNase [0.1 mg/mL; Roche]) and minced with scissors ...