Labshake search
Citations for Roche :
2801 - 2850 of 9201 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Systems Biology 2021Quote: The digested lysates were mixed 1:1 with 2x IP buffer (200 mM Tris, pH 8.0; 600 mM NaCl; 4% Triton X-100; 2x Roche Complete EDTA-free protease inhibitors), and then kept on ice for no more than a few hours prior to antibody addition ...
-
bioRxiv - Physiology 2022Quote: ... This was followed by a perfusion at 4 mL/min for 40 min with the same solution containing 1 mg/mL of collagenase A (Roche Diagnostics GmbH, Mannheim, Germany) plus 300 µM ethylene glycol tetraacetic acid (EGTA ...
-
bioRxiv - Developmental Biology 2021Quote: ... Probes were hybridized at 56°C overnight and subsequently detected by anti-DIG at 4°C overnight (1:1000; Roche 11-207-733-910) with secondary tyramide signal amplification for 2h at room temperature in the dark (AKOYA Biosciences ...
-
bioRxiv - Zoology 2024Quote: ... Samples were pre-incubated for 2 h in blocking solution (25% deactivated goat serum in PBT) and incubated overnight at 4°C in blocking solution with anti-DIG antibody conjugated to alkaline phosphatase (Roche Diagnostics, Germany; 1:2000). After several washes in PBT ...
-
bioRxiv - Cell Biology 2022Quote: ... pellets were resuspended in 100 µL of lysis buffer (50 mM Tris pH 7.5, 1 mM EDTA, 3 mM DTT, 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche], 1.1 mM PMSF, and 1X Pepstatin A) and beaten on a bead-beater for 5 minutes at room temperature with 100 µL of acid-washed glass beads (cat ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were lysed with 4% SDS lysis buffer (4% SDS, 150 mM NaCl, 50 mM triethanolamine pH 7.4, Roche protease inhibitor, benzonase). Protein concentrations were determined by the BCA assay (Pierce) ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Biochemistry 2020Quote: ... 4 cOmplete EDTA-free Protease Inhibitor Cocktail tablets (Roche), 500 U benzonase ...
-
bioRxiv - Cancer Biology 2019Quote: ... for 4 minutes and Bluing reagent (Roche #760-2037) for 4 minutes.
-
bioRxiv - Cancer Biology 2021Quote: ... 4 mL of Red Blood Cell Lysis Buffer (Roche) were added before being gently rocked for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... SDS 0.4%) + Proteinase-K 4 mg/ml (Roche, 3115887001) and incubated for 2h at 55°C ...
-
bioRxiv - Microbiology 2024Quote: ... (4) we used KAPA HiFi master mix (Roche, 07958935001) and 19 cycles of PCR.
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x PhosStop® phosphatase inhibitors (Roche), 4 μL of 20x cOmplete® protease inhibitors (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μL of 20x cOmplete® protease inhibitors (Roche) and 1.6 μL of 1 M DTT ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Physiology 2022Quote: ... pH 7.4) containing 3 mg/mL collagenase A (Roche Diagnostics, Germany). Oocytes of stage IV and V were manually defolliculated and each oocyte was injected with 50-100 ng of mRNA encoding for the respective photoreceptor CNG channels ...
-
bioRxiv - Neuroscience 2019Quote: ... and was subsequently digested with 3 mg/mL Collagenase/Dispase (Roche) in PBS (1X ...
-
bioRxiv - Neuroscience 2023Quote: ... with 3 mg/mL DNAse I grade II (Roche, Cat# 104159). The cell suspension was centrifuged at 1,300 rpm for 5 minutes with 7.5% BSA solution (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3 cOmpleteTM mini EDTA-free Protease Inhibitor cocktail tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... Fat was digested enzymatically with 3 mg/ml collagenase/dispase (Roche) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with 3 U PNGase F (Roche diagnostics) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Animals were injected with diazepam (3 mg/kg, Roche Pharmaceuticals, CH), gaboxadol (10 mg/kg ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM CaCl2 and protease inhibitor cocktail (CompleteTM EDTA-free, Roche), and homogenized by 10 strokes using Dounce device ...
-
bioRxiv - Microbiology 2020Quote: ... bacteria were harvested by centrifugation at 6,000 g for 10 min at 4°C and resuspended in L Buffer (25 mM Tris-HCl, 500 mM NaCl, 10 mM Imidazole, 1 mM PMSF, 5 % Glycerol, pH 8, containing Roche protease inhibitor cocktail). Bacteria were then lysed by sonication ...
-
bioRxiv - Molecular Biology 2019Quote: ... 250 mM sucrose, 5 mM MgCl2, 1 mM EGTA, 0.05% Tween-20, 0.5 mM DTT, 1x protease inhibitors [Roche], 0.4 u/μl RNase inhibitor). The nuclei or permeabilized cells were flash-frozen and stored at −80°C (10 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... along with the appropriate antibody (mouse HA 12CA5, 7.5 μl 0.4 mg/ml, Roche; mouse M2 FLAG, 5 μl 1 mg/ml, Sigma), before incubating at 4 °C on a rotating wheel at 14 rpm for 15-18 h ...
-
bioRxiv - Neuroscience 2022Quote: ... 2X SSC was replaced with 1X DNase buffer for 5 min and then a 1:50 dilution of DNase I in DNase buffer (DNase I recombinant, RNase-free, Roche, Cat. No. 04716728001), and incubated for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... 2X SSC was replaced with 1X DNase buffer for 5 min and then a 1:50 dilution of DNase I in DNase buffer (DNase I recombinant, RNase-free, Roche, Cat. No. 04716728001), and incubated for 1 hour at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... ESCs cells and neurospheres were harvested and lysed in TEN buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.5% Na-Deoxycholate, supplement with Roche cOmplete™ Protease Inhibitor). The lysates were quantified by the Bradford method and equal amount of proteins were loaded for Western blot assay ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, 5 mM EDTA, 50 mM NaF, 1 mM PMSF supplemented with Roche 1X Halt Protease inhibitor cocktail), incubated for 1 hour at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested and lysed using immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Approximately 1.5 mg of lysate from each sample was incubated with brachyury antibody at 4°C for 4 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were pooled together and resuspended in 1.5 mL immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Cells were then incubated for 30 minutes on ice prior to centrifugation at high speed (15,000 rpm ...
-
bioRxiv - Immunology 2020Quote: ... at 37° C 5% CO2 in 96 well plates in the presence of IL2 (GIBCO 100 IU/mL or Roche 1 ng/mL). Additional conditions included 1 ng/mL TGFβ (GIBCO) ...
-
bioRxiv - Genetics 2024Quote: ... Washed cells were carefully resuspended in 570 μL Buffer A with additives (0.2 mM spermidine, 0.5 mM spermine, 1 mM PMSF, ½ cOmplete ULTRA protease inhibitors tablet, Roche, per 5 mL Buffer A) and permeabilized with 0.1% digitonin in 30 ° C water bath for 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... then lysed in ice-cold NP-40 lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1mM EDTA, 1% NP-40, 5% glycerol, Roche cOmplete protease inhibitor cocktail) by trituration followed by incubation on ice for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Washed cells were carefully resuspended in 570 μL Buffer A with additives (0.2 mM spermidine, 0.5 mM spermine, 1 mM PMSF, ½ cOmplete ULTRA protease inhibitors tablet, Roche, per 5 mL Buffer A) and permeabilized with 0.1% digitonin in 30 ° C water bath for 5 min ...
-
bioRxiv - Plant Biology 2021Quote: ... The sheared DNA fragments were end-repaired and deoxyadenosine-tailed in a 60 µL volume with 3 µL End Repair & A-Tailing Enzyme Mix and 7 µL End Repair & A-Tailing Buffer using a KAPA Hyper Prep Kit (KAPA Biosystems, USA) according to the manufacturer instructions (20°C 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Biochemistry 2023Quote: ... uridine 5’-diphospho-N-acetyl-glucosamine (UDP-GlcNAc) and cytidine-5’-monophospho-N-acetylneuraminic acid (CMP-Neu5Ac) were obtained from Roche Diagnostics [UDP-Gal ...
-
bioRxiv - Developmental Biology 2023Quote: ... 250 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Nonidet P-40 and protease inhibitor cocktail from Roche, France), were then added to the mix and gently rotated at 4°C for 30 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA probes were created from in vitro transcription of PCR products carrying the T7 RNA polymerase recognition sequence at one end and synthesized by using a digoxigenin (Dig)-labeling kit (Roche). Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The levels of relevant mRNAs were quantitated by real-time PCR using One Step SYBR GREEN RT-PCR Kit (Roche) in a Light Cycler instrument (Roche Applied Science ...
-
bioRxiv - Genomics 2020Quote: ... Entire material of one conversion was equally distributed to a 96-well plate and amplified via PCR using KAPA HiFi Uracil+ Kit (Roche) in a total volume of 16µl ...
-
bioRxiv - Genomics 2020Quote: ... Illumina adapters and indices were added in the same one-step PCR reaction using the KAPA HiFi HotStart ReadyMix (Roche). The PCR product was purified using the QIAQuick PCR Purification Kit (Qiagen ...