Labshake search
Citations for Roche :
2701 - 2750 of 7758 citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... and T7 transcription kit (Roche). 1 × 107 HEK293T cells were suspended in 1 mL RIP buffer (25mM Tris at pH7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcriptor First strand kit (Roche) was used for cDNA synthesis and qRT-PCR was performed using FastStart Essential DNA Probes Master and gene specific probes from Universal Probe Library (Roche) ...
-
bioRxiv - Genomics 2024Quote: ... with SeqCap Adapter Kit (Roche). Ampure XP beads were used in all of the bead-based cleanup steps ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were washed twice with 0.1% Triton-X in PBS and blocked with 3% BSA (constituted from powder BSA, Roche Fraction V ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5–10 × 106 HEK-293 or MEF cells were washed with cold sucrose-containing solution I (0.5 M sucrose, 3 mM MgCl2 with Cocktail protease inhibitor, Roche), harvested by scraping into 1 ml solution I and sonicated in a BioRuptor for 10 cycles (15 sec ON/15 sec OFF) ...
-
bioRxiv - Cell Biology 2019Quote: ... ∼100 µl glass beads and 100 µl of lysis buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 15 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to each dried pellet ...
-
bioRxiv - Neuroscience 2019Quote: ... The plates were then washed 3 times with ~300 μl of wash buffer (0.05%Tween in PBS) and blocked with 150 μl of 3% BSA (Fraction V, protease-free, Roche Diagnostics Corporation ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Immunology 2021Quote: ... The pancreas was inflated via the common bile duct by adding ∼3 ml of 0.8mg/ml Collagenase P (Roche) and 10µg/ml Dnase I (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were then washed 3 times for 5 min each in PBST and blocked with 1X Blocking Reagent (Roche) in PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... 12-20 ml of pre-warmed to 37 °C enzyme buffer solution (EBS) with 2.3 U of Liberase Blendzyme 3 recombinant collagenase (Roche) were cannulated into the vena cava to isolate hepatocytes ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μg each lysate was pre-cleared with 20 μl of Protein A agarose beads (3 mg/ml, Roche) in 200 μl for 1 hour at 4°C on a Labquake Rotator (Barnstead Thermolyne) ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked with 3% skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (1:1,000, Roche) or rabbit anti-aldolase (Mesén-Ramírez et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... The pellet was resuspended with 3 ml S1 solution (0.25 M sucrose, 10 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) by pipetting up and down ...
-
bioRxiv - Neuroscience 2022Quote: ... and then reacted with 0.375 mg/mL nitroblue tetrazolium and 0.188 mg/mL 5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP; Roche Diagnostics) for 27—42 h.
-
bioRxiv - Physiology 2022Quote: ... for 3 min and incubated twice for 3 min with CSK buffer containing 0.5% Triton X-100 and complete protease inhibitors cocktail (catalog no. 11873580001, Roche). Cells were after washed with PBS-S ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sorted cells were pelleted for 5 min with 2000 rpm at 4°C and resuspended in 500 ul hypotonic buffer (HB; 20mM Tris-HCl, pH7.5, 10mM NaCl, 3 mM MgCl2) with added protease inhibitor (Roche). After 30min incubation on ice ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 mM KCl, 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 0.1 mM GTP, 3 U/ml benzonase, 1X Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 µL protein breakage buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 20 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to the samples ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Immunology 2020Quote: Mice were euthanized and lungs were gently homogenized in HEPES buffer containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNaseI (30 μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 0.5 mM CaCl2 and 1 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... then the beads were washed 3 × with washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 100 μM CaCl2 ...
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to 3-4 ml of digestion media containing 0.1 mg/ml Liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... we blocked the slides for 1-hr using 3% BSA/PBS with 0.1% Tween and incubated slides with 1:200 secondary antibodies (Roche) in 3% BSA/4X SSC with 0.1% Tween and BSA at room temperature for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... Myelin was washed by dilution in HBSS and centrifuged at 400 x g for 5 min at 4 °C before suspending in 3 mL ice cold 0.32 M sucrose solution containing protease inhibitor cocktail (Roche). Next ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 million cells were pre-extracted on ice with ice-cold 30 µl CSK buffer (25 mM HEPES pH 7.4, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose, 0.2% Triton X-100, 1 Roche cOmplete protease inhibitor cocktail tablet per 50 ml of buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Cancer Biology 2024Quote: ... nuclei were isolated from 5 million cells with hypotonic buffer (20 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, protease inhibitors (Roche)) for 15 min on ice ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 μl of MNase buffer (0.3 M Sucrose, 85 mM Tris, 3 mM MgCl2, 2 mM CaCl2, 2.5U of micrococcal nuclease: Roche 10107921001) was added in to each tube (0.5 millions of cells per tube) ...