Labshake search
Citations for Roche :
2651 - 2700 of 5627 citations for Total Carbohydrate Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... alkaline phosphatase activity was detected using an HNPP fluorescence detection kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed using a Transcriptor first-strand cDNA synthesis kit (Roche) using random hexamers as primers (25°C for10 min ...
-
bioRxiv - Microbiology 2021Quote: ... DNA sequencing libraries were prepared using the PCR-free KAPA HyperPrep Kit (Roche). Libraries were sequenced on an Illumina NextSeq 500 and the quality of the raw sequencing reads was analysed with FastQC (version 0.11.4 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using the High Pure Viral RNA Kit (Roche, Basel, Switzerland). Partial RdRp was amplified using the SuperScript III OneStep RT-PCR and Platinum Taq Enzyme kit (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... whose copy number was determined using the Cobas 6800 HIV-1 kit (Roche) was included in every RNA isolation/qPCR run ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was harvested using the High Pure RNA Isolation Kit (Roche, Basel, Switzerland). Two independent samples were analyzed ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using the Roche Transcriptor First Strand Kit (04896866001, Roche). qPCR was carried out using cDNA diluted 1:7 ...
-
bioRxiv - Genomics 2021Quote: ... cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche, (07962193001). Libraries were quantified using a KAPA Library Quantification Kit (Roche ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library was quantified using a KAPA library quantification kit (Roche), and further PCR amplification was performed using Phusion Hot Start II DNA polymerase (Thermo Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by real-time PCR using the KAPA Library Quantification kit (Roche) with the QuantStudio-7flex Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by real-time PCR using the KAPA Library Quantification kit (Roche) with the QuantStudio-7flex Real-Time PCR system (Thermo) ...
-
bioRxiv - Genetics 2020Quote: ... Library generation was performed using the KAPA Hyper Prep Kit (KK8504, Kapa Biosystems). After amplification and quantification ...
-
bioRxiv - Immunology 2021Quote: ... The following qRT-PCR was performed using a RealTime Ready PCR Kit (Roche) and Taqman primer-primer-probe mixes ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA-seq library was constructed by KAPA mRNA Hyper Prep Kit (KAPA BIOSYSTEMS) and SeqCap Adapter Kit (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by qPCR using a Kapa Library Quantification Kit (Kapa Biosystems, KK4835).
-
bioRxiv - Cancer Biology 2020Quote: ... then quantified using the KAPA Library Quantification Kit for Illumina platforms (Kapa Biosystems). Libraries were submitted to PE75 sequencing on Illumina NextSeq500 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA extraction was performed manually using the High Pure RNA isolation kit (Roche) with an on-column DNase treatment according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-seq libraries were prepared using the KAPA Stranded mRNA-Seq Kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The shotgun sequencing library was constructed using the KAPA Hyper Prep Kit (Roche). Libraries were sequenced on the DNBSEQ-G400 (BGI ...
-
bioRxiv - Neuroscience 2022Quote: TUNEL staining was performed using the in-situ cell death detection kit (Roche) in sagittal paraffin sections of 4μm ...
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were prepared by using the KAPA HyperPrep kit (Roche, Basel, Switzerland, # 7962363001) according to the manufacturer’s specifications ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR was performed using the FastStart Essential DNA Green Master kit (Roche, 06924204001) on LightCycler® 96 instrument (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was extracted using the High Pure RNA isolation kit (Roche Molecular Systems) according to manufacturer’s instructions and following the general precautions required for RNA work (39) ...
-
bioRxiv - Genomics 2022Quote: ... The DNA fragments were prepared with the KAPA HTP Library Preparation Kit (Roche) for sequencing ...
-
bioRxiv - Genomics 2022Quote: ... and libraries prepared using the KAPA Hyper Prep kit for DNA (Roche KK8504). Truncated universal stub adapters were ligated to DNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library enrichment was performed with the KAPA HotStart PCR kit (Roche Diagnostics KK2502) in 50 μl of total reaction volume (10 μl 5X KAPA buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was synthesized with Transcriptor First Strand cDNA synthesis kit (Roche, Basel, Switzerland). qPCR experiments were performed using QuantStudio 5 Real-time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: The In Situ Cell Death Detection Kit Fluorescein (Roche, N°11684-795-910) was used for detecting dying cells in intact Hv_Basel ...
-
bioRxiv - Cell Biology 2022Quote: ... Library preparation was done with the KAPA DNA or RNA Hyperprep kit (Roche). Ligation was made with Illumina dual-index UMI (IDT) ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled (2.5nM) ...
-
bioRxiv - Immunology 2022Quote: ... Libraries were quantified by qPCR using a KAPA Library Quant Kit (KAPA Biosystems). Normalized libraries were pooled (0.23nM) ...
-
bioRxiv - Genomics 2022Quote: ... Linear NGS library construction was performed using a KAPA HyperPrep library kit (Roche) according to published protocols ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... constructed barcoded libraries for sequencing using KAPA HyperPrep kits (Roche Sequencing, Pleasanton, CA) with a target fragment size of 500 bp ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation was performed using a commercially available kit provided by KAPA Biosystems (KAPA Hyper Prep with Library Amplification Primer Mix ...
-
bioRxiv - Genomics 2022Quote: Libraries are quantified via qPCR using the KAPA Library Quantification Kit (Roche 0796020400), which specifically analyzes sequencing-competent fragments ...
-
bioRxiv - Genomics 2022Quote: BANC-seq libraries were prepared using the Kapa Hyper Prep Kit (Kapa Biosystems) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was done with the SYBR Green I Master kit (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... LDH release levels were analyzed using a Cytotoxicity Detection Kit (Roche, Basel, Switzerland). Purified Ply(1μM)was co-cultured with various concentrations of alnustone at 37°C for 30min ...
-
bioRxiv - Microbiology 2022Quote: ... The KAPA HiFi Hot Start Ready Mix kit (Kapa Biosystems, Woburn, MA, USA) was used for PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Microbiology 2022Quote: ... JE1 amylase activities were measured in culture supernatants using the AMYL kit (Roche/Hitachi #11876473 001 ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was generated by using the Transcriptor First Strand cDNA Synthesis Kit (Roche). qPCR was performed using FastStart SYBR green master mix (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.
-
bioRxiv - Pathology 2022Quote: ... and quantified using the KAPA Library quantification kit for Illumina platforms (KAPA Biosystems). One hundred base pair single-read sequencing of multiplexed samples was performed on an Illumina HiSeq 4000 sequencer ...
-
bioRxiv - Plant Biology 2022Quote: ... The library was quantified with the KAPA Library Quantification Kit (Roche, Basel, Switzerland), and the fragment size of the library was verified using an Agilent Technology 2100 bioanalyzer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mRNA was isolated with an mRNA Isolation Kit (Roche, # 11 741 985 001) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the LightCycler Fast Start DNA Master SYBR Green I kit (Roche Diagnostics) as previously described (Maire et al. ...
-
bioRxiv - Microbiology 2022Quote: ... LDH in the cell supernatants was quantified using the Cytotoxicity Detection kit (Roche), following manufacturer’s instructions ...