Labshake search
Citations for Roche :
2651 - 2700 of 7151 citations for Human Protein Patched Homolog 2 PTCH2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... and then resuspended in lysis buffer (10 mM Hepes-NaOH, 100 mM NaCl, 2 mM EDTA, 1 mM EGTA, 1 mM PMSF, 0.2% SDS, 0.1% sarkozyl, Roche proteases inhibitor). Sonication was performed with a Misonix sonicator (fifteen cycles of 20 seconds sonication interspaced by a pause of 50 seconds) ...
-
bioRxiv - Neuroscience 2019Quote: ... Clear supernatant was incubated with 2 ml of pre-equilibrated Ni-beads (cOmplete™ His-Tag Purification Resin, Roche, Switzerland) for 1 h and then transferred to a sigma column to be washed consecutively with His-binding buffer (50 mM HEPES pH 8.0 ...
-
bioRxiv - Physiology 2021Quote: ... and 400 ml of sample was placed in a 2-l wide-mouthed Erlenmeyer culture flask with 100 ml of freshly prepared blendzyme (Roche Liberase TM ...
-
bioRxiv - Cell Biology 2021Quote: ... 150 mM KOAc, 2 mM MgCl2, 1 mM CaCl2, 0.2 M sorbitol, 10mM PMSF, 2x protease inhibitor cocktails [Roche, 11873580001]), dropped into liquid nitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... We collected the flow through and replaced the lysis buffer with crystallization buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 2 mM DTT (1,4-Dithiothreitol, Roche, Basel, Switzerland)) using a 10 kDa MWCO filter ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Plant Biology 2020Quote: ... the water was removed with a pipette and 75 μl of Luminol-Mastermix (2 μg/ml horseradish peroxidase (Type II, Roche), 5μM L-012 (WAKO chemicals) ...
-
bioRxiv - Plant Biology 2021Quote: ... Elicitation was performed with the indicated concentration of peptides and 2 μg/ml horseradish peroxidase (Type II, Roche, Penzberg, Germany) and 5μM L-012 (FUJIFILM Wako chemicals ...
-
bioRxiv - Microbiology 2021Quote: ... the remaining dermis was washed in Ca2+ and Mg2+ free PBS 5 times and incubated in a digestion buffer containing 2 mg/ml collagenase A (Roche), 100 µg/ml of DNase I (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial pellets were resuspended in 20 ml of sodium phosphate buffer A (20 mM Na2HPO4 x 2 H2O, 500 mM NaCl with a protease inhibitor cocktail (Roche) each and cells were disrupted using a French Press (Sim-Aminco Spectronic Instruments ...
-
bioRxiv - Microbiology 2021Quote: ... The cell lysate was prepared by sonication of 2×108 cells on ice in 100 mM sodium phosphate buffer pH 7 including EDTA-free Complete Protease Inhibitors (Roche) and 0.01% TX-100 ...
-
bioRxiv - Molecular Biology 2021Quote: Cell lysates were prepared in 2× Laemmli loading buffer supplemented with cOmplete protease inhibitor and PhosSTOP phosphatase inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... femurs were cut roughly and incubated with 2 Wunsch units of Liberase TM and 1mg of Pronase (Sigma/Roche 10165921001) in 2ml Ca2+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... sectioned and stained with various primary antibodies (detailed in Table 2) on an automated system (Ventana Discovery Ultra, Roche, Switzerland). “Intensity” (as specified on Y axes in Figure 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transposed chromatin was amplified using customized Nextera PCR Primer 1 and Primer 2 (barcode) (31) and HotStart KAPA ReadyMix (Roche). Libraries were quantified by Qubit using the DS DNA HS kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 200 mM NaCl, 1% NP-40, 2 mM MgCl2, 10% glycerol, NaF +Na3VO4, complete mini tablets without EDTA, Roche). Lysates were incubated on ice for 15 minutes and centrifuged at 17,000xg at 4°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were spun (420 RCF x 2 min on LCM-3000 plate centrifuge (Grant Instruments, Royston, UK) before analysis on the Light Cycler 480 (Roche). Samples were run for 50 cycles (10s at 95°C and 30s at 60°C) ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... hippocampi from each animal were homogenized in ice-cold Homogenization buffer (2 M sucrose, 500 mM HEPES (pH 7,4)) containing complete Protease Inhibitor (Roche/Sigma) and spun down for 10 min at 1000 x g at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... The cells were washed with PBS and crosslinked for 30 min in 2 ml ice cold 1% formaldehyde containing 2X Complete EDTA-free Protease Inhibitor Cocktail (Roche). Cross-linking was stopped by the addition of glycine to 333 mM ...
-
bioRxiv - Synthetic Biology 2022Quote: Pellets were lysed via sonication of a 33 percent (w/v) cell suspension in 10 mM Tris pH 7.5/2 mM CaCl2 with protease inhibitor (Roche, 11836170001), cleared with centrifugation at 4C ...
-
bioRxiv - Neuroscience 2022Quote: ... the reaction was performed with 2 x Hieff qPCR SYBR Green Master Mix (Yeasen) and detected by LightCycle 480 Real-Time PCR machine (Roche). For RNA-seq ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Plant Biology 2022Quote: ... Glucose content was then measured by spectrophotometry after a 2 enzymes reaction with hexokinase and glucose-6-phosphate dehydrogenase (Roche).
-
bioRxiv - Biochemistry 2022Quote: Proteins were extracted from adherent cells by scraping into extraction buffer (1× LysisM, 1× protease inhibitor cocktail, 2 x phosphatase inhibitor cocktail (all Roche), 2 mM sodium orthovanadate (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... One mL of yeast lysate (1-2 mg/mL) prepared in column buffer freshly supplemented with protease and DUB inhibitors (cOmplete mini EDTA-free (Roche), 10 mM NEM ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cell pellet was resuspended in cold extraction buffer (10 mM Tris pH 7.5, 2 mM NaV, 50 mM NaF, 50 mM β-glycerophosphate, PhosSTOP Phosphatase inhibitor (Roche), cOmplete EDTA-free Protease Inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Membranes were UV crosslinked with 120 mJ/cm2 twice and then pre-hybridized for 2 hrs using DIG Easy Hyb (Roche). Fluorescent end-labeled oligos to the exons of tRNA-R1 were obtained from IDT (See Table S3) ...
-
bioRxiv - Neuroscience 2020Quote: ... To lyse the cells medium was removed and the well was washed with 2 ml ice cold PBS before 100 µl lysis buffer was applied (RIPA buffer supplemented with PhosSTOP (Roche) and protease inhibitors (cOmplete Mini ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM EDTA) supplemented with a cocktail of protease inhibitors (Complete Protease Inhibitor without EDTA, Roche Applied Science, Indianapolis, IN) and phosphatase inhibitors (Phosphatase Inhibitor Cocktail 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... there is a need to stop it after 2 hours by a single injection of diazepam (Valium®, 10 mg×kg−1, i.p.; Roche). Rats were then hydrated with 2 mL of saline solution (0.9% NaCl ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR (RT-qPCR) used 2×RealStar Green Fast Mixture (GenStar) with a Real-time PCR Detection System (LightCycler96, Roche). The following primers were used in the amplification ...
-
bioRxiv - Bioengineering 2021Quote: ... P14 CD8+ T cells were activated for 24 h as described above and resuspended in T cell media + 30 U/ml rhIL-2 (Roche) at 2 × 106 cell/ml ...
-
bioRxiv - Bioengineering 2021Quote: ... The skin was finely minced with a scalpel and placed for 30 min at 37 °C on a shaker in a digesting enzyme cocktail of 2 mg/ml Collagenase P (Roche), 2 mg/ml Dispase (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... 18 µl cleared cell lysate or brain homogenates (20-100 µg based on Tau aggregate content) were incubated with 2 µl 1 mg / ml pronase (Roche) at 37° C for one hour ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 mM EGTA) with Halt phosphatase buffer inhibitor (Fisher: PI78420) and Complete mini EDTA-free protease inhibitor (Roche: 4693159001). Samples were sonicated at low power (Qsonica Q55 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Developmental Biology 2022Quote: ... Clones grown from sorted cells were expanded and DNA samples from individual clones were extracted with Lucigen quick DNA buffer (68 °C for 15 min followed by 98 °C for 2 min), and genotyped by PCR with primers (F: GGTCCCCTTGGAACTTCATGC, R: CCTTCAACAACTAATAGCAGGG) with 2x KAPA HiFi HotStart ReadyMix (Roche) using the following PCR program (95 °C for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Each DNA sample was diluted to 1 ng/μL and 2 μL were used for amplification using PrimeTime Gene expression Master Mix (IDT) with LightCycler96 (Roche) instrument ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Immunology 2022Quote: ... and spleen were harvested and homogenated in PBS for CFU counting or in isotonic buffer (Tris HCl 50 nM, EDTA 2 mM, PMSF 1 mM [Roche Diagnostics GmbH] ...
-
bioRxiv - Cell Biology 2022Quote: ... pancreas was perfused through the common bile duct with 2 mL of 0.8 mg/mL collagenase P (Roche, Indianapolis, IN) in Hanks’ balanced salt solution [HBSS] with Ca2+ and Mg2+ (Corning ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... PDX tumors were minced with No.22 blades into 1-2 mm fragments then digested with 1mg/ml collagenase/dispase (Roche) for 30-40 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were in contact for 2 hours at room temperature with a mouse monoclonal primary antibody anti-BrdU (1/1000 dilution) (Roche), then rinsed and incubated for 30 min with a fluorescent secondary antibody Alexa-633nm goat anti-mouse (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... cells were vortexed and passed through a syringe in ubiquitin lysis buffer (2% SDS, 150mM NaCl, 10 mM Tris HCl pH 8, 1 Roche protease inhibitor tablet ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA samples were subsequently incubated for 20 min at 37 °C with 2 U of DNase I (Roche, Germany). The absence of DNA contamination in the samples was checked by the lack of conventional PCR amplification of the GP43 gene in the isolated RNA ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... one organoid per condition was lysed with Urea Buffer (7M Urea, 2M Thiourea, 2% CHAPS, 1% DTT (w/v) and Complete protease inhibitor cocktail (Roche) in MilliQ water) ...