Labshake search
Citations for Roche :
2551 - 2582 of 2582 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were pooled together and resuspended in 1.5 mL immunoprecipitation buffer (25 mM Tris pH 7.4, 150 mM NaCl, 0.4% NP40, 5% glycerol, 1X protease inhibitor cocktail from Roche and 1 mM of PMSF). Cells were then incubated for 30 minutes on ice prior to centrifugation at high speed (15,000 rpm ...
-
bioRxiv - Immunology 2020Quote: ... at 37° C 5% CO2 in 96 well plates in the presence of IL2 (GIBCO 100 IU/mL or Roche 1 ng/mL). Additional conditions included 1 ng/mL TGFβ (GIBCO) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM DTT, 150 mM NaCl, 5 mM MgCl2, 0.001% Triton X-100, 1mM PMSF, 0.2 mM GDP, Roche cOmplete EDTA-free protease inhibitors) and lysed with a microfluidizer ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% SDS, 1 mM EDTA, 1 mM DTT, 1 mM Na3VO4×2H2O, 5 µM pepstatin A, 10 µM leupeptin, 2X Roche protease inhibitor cocktail), 200µl glass beads were added ...
-
bioRxiv - Plant Biology 2022Quote: ... and then mixed with 4ml protein extraction buffer (50mM Tris/HCl pH 7.5, 5% glycerol, 150mM NaCl, 0.2% triton X-100, cOmplete™ EDTA-free protease inhibitor tablets [Roche] - one per 10ml buffer) as soon as the ground tissue had reached room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... protein extraction buffer (50mM Tris/HCl pH 7.5 or HEPES pH 7.5, 150mM NaCl, 5% glycerol, 0.5% NP-40, cOmplete™ EDTA-free protease inhibitor tablets [Roche] - one per 10ml buffer) was added to the tissue and grinding was continued until a homogenous suspension was formed ...
-
bioRxiv - Genetics 2024Quote: ... Washed cells were carefully resuspended in 570 μL Buffer A with additives (0.2 mM spermidine, 0.5 mM spermine, 1 mM PMSF, ½ cOmplete ULTRA protease inhibitors tablet, Roche, per 5 mL Buffer A) and permeabilized with 0.1% digitonin in 30 ° C water bath for 5 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in 10 ml of extraction buffer (pH 6.7) (250 mM sucrose, 120 mM KCl, 10 mM MOPS, 5 mM MgCl2, 1 mM DTT, 1 Roche protease inhibitor cocktail tablet) (Vought et al ...
-
bioRxiv - Biochemistry 2023Quote: ... then lysed in ice-cold NP-40 lysis buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1mM EDTA, 1% NP-40, 5% glycerol, Roche cOmplete protease inhibitor cocktail) by trituration followed by incubation on ice for 10 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... pH 7.5, 150 mM NaCl, 1 mM EDTA, 10 % [v/v] glycerol, 1 mM DTT, and 1 × complete Protease Inhibitor [Roche; Cat. No. 058929700001]) was added to homogenised plant material (100 μl extraction buffer per 100 mg plant material) ...
-
bioRxiv - Genetics 2023Quote: ... Washed cells were carefully resuspended in 570 μL Buffer A with additives (0.2 mM spermidine, 0.5 mM spermine, 1 mM PMSF, ½ cOmplete ULTRA protease inhibitors tablet, Roche, per 5 mL Buffer A) and permeabilized with 0.1% digitonin in 30 ° C water bath for 5 min ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... ear punch biopsy samples were homogenized in lysis buffer (50 mM Tris-base, 150 mM NaCl, 5 mM EGTA supplemented with EDTA-free complete protease inhibitor (Roche Diagnostics GmbH, Mannheim, Germany) and 0.5% Triton X-100) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Microbiology 2019Quote: ... DNA fragments encompassing TPP riboswitches and the first 5 codons of the downstream gene were amplified from genomic DNA by PCR using HiFi Taq MasterMix (KAPA Biosystems, Wilmington, MA, USA) and inserted in frame preceding the nanoluciferase gene in the pNBU2 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on a rotator and S1 (1 ml for cerebellum and 1 ml for cerebrum) was incubated with 5 μg of anti-HA mAb (Roche, clone 12CA5, RRID: AB_514505) at 4°C for 60 min on a rotator ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIGprobes were detected with antibodies in MABT containing 5% horse serum appropriate for NBT/BCIP in situ hybridization (Roche anti-DIG-AP 1:1000) or for FISH (Roche anti-DIG-POD 1:1000) ...
-
bioRxiv - Biochemistry 2019Quote: ... pooled together and placed in buffer H (10 mM HEPES pH 7.5, 5 mM MgCl2, 25 mM KCl, 0.25 M sucrose supplemented with Complete protease inhibitors cocktail, Roche Products Ltd, Welwyn Garden City, UK) at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell pellets were resuspended in lysis buffer (50 mM HEPES-NaOH, pH 7.5, 500 mM NaCl, 5% v/v glycerol, 1 mM TCEP-NaOH, Roche protease inhibitor cocktail EDTA-free) at the ratio of 50 ml / L equiv ...
-
bioRxiv - Molecular Biology 2021Quote: ... and homogenized in 5 volumes of ice-cold PBS containing 1% NP-40 and Complete® protease inhibitor cocktail tablets (Roche Diagnostics, Basel, Switzerland) using 2×10 clockwise strokes with 5 s rest time ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2022Quote: ... mCIT tagged proteins were revealed by using respectively GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche; at 1/1000 in 5 % milk over-night) as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cell Biology 2023Quote: ... and lysis buffer A (50 mM Tris-HCl, 5 mM EDTA, 10 mM NaN3, and Complete™ EDTA-free tablet; Roche Diagnostics, Mannheim, Germany); disrupted with glass beads at 4 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were lysed in 100 µl lysis buffer (5 ml contain: 10 mM Tris-HCl pH 7.5, 4% SDS, 1 PhosSTOP tablet [Roche], a scoop of DNase I [NEB]) for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 mM NaCl, 30 mM imidazole, 1 M urea, 1% v/v Triton X-100, 5 mM beta-mercaptoethanol, with Roche EDTA-free cOmplete protease inhibitor) at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... 42 ℃ for 5 min and 95 ℃ for 10 s followed by 40 cycles of 95℃ for 5 s and 60 ℃ for 20 s on an LightCycler® 480 Instrument (Roche Diagnostics Ltd, Rotkreuz, Switzerland). The absolute quantification of SARS-CoV-2 RNA levels was performed by comparison to a standard curve and shown as SARS-CoV-2 RNA copies per mouse ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Immunology 2024Quote: ... and 0.5% Triton X-100) with 1x protease and phosphatase inhibitors (c0mplete™ Protease Inhibitor Cocktail, Roche, product number 04693159001; PhosSTOP™, Roche, product number 04906837001). The resulting lysate was transferred to a labeled 1.5mL tube and placed on ice ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Physiology 2021Quote: ... denatured for 10 minutes at 80°C in hybridization buffer (0.1M Tris, pH 7.2; 25mM MgCh; 70% formamide [Sigma-Aldrich, Saint Louis, MO], 5% blocking reagent [Roche] with 1.0μg/mL of Cy3-labelled (F3002) CENPB-specific [ATTCGTTGGAAACGGGA] peptide nucleic acid (PNA ...