Labshake search
Citations for Roche :
201 - 250 of 290 citations for ZG16 Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... and mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) was used in the immunostaining assay.
-
bioRxiv - Cancer Biology 2021Quote: ... Pooled sample libraries were hybridized with SeqCap EZ Human Exome v3.0 probes (Roche) for WES ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 200 U/ml of recombinant human IL-2 (Roche, Nutley NJ, USA). All cell lines were grown in cell culture incubators at 37°C in the presence of 5% CO2.
-
bioRxiv - Molecular Biology 2023Quote: ... 3×10−4 M MTG and 300 μg/ml human transferrin (Roche, 10652202001)) in a triple vent petri 10 cm dishes (Thermo fisher ...
-
bioRxiv - Immunology 2024Quote: Human monocytes were lysed using RIPA buffer supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitors (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% Penicillin/Streptomycin and 20 IU human IL-2 (Roche Diagnostics, Mannheim, Germany) for 5d ...
-
bioRxiv - Cancer Biology 2021Quote: ... All human cell lines were provided by the Roche Non-Clinical Biorepository from Roche Basel or the Roche-Innovation Center Zurich (RICZ) ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... Evaluation of the ratio Leishmania/human DNA was performed by qPCR on LightCycler480 (Roche) using SensiMix SYBR No-ROX (Bioline ...
-
bioRxiv - Genetics 2020Quote: ... and hybridized to human exome probes using the SeqCap EZ Prime Exome kit (Roche). The resulting exome libraries were sequenced with paired-end 150 bp Illumina reads on the HiSeq or NextSeq platforms at Admera Health (South Plainfield ...
-
bioRxiv - Genetics 2021Quote: Human BE5.1 was amplified using high fidelity PCR (Expand high fidelity system, Roche, UK) from human DNA (Cambio ...
-
bioRxiv - Genomics 2022Quote: ... fourteen non-coding regions of interest were PCR amplified from human genomic DNA (Roche) using the Phusion High-Fidelity PCR Kit (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... 30 ml of additional human dynein lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche) was added to the frozen cell pellet ...
-
bioRxiv - Neuroscience 2020Quote: ... The RNA probes complementary to human METTL7B cDNA (NM_152637.2) were labeled with digoxigenin-UTP (Roche). After acetylation ...
-
bioRxiv - Genetics 2022Quote: ... Probes were then mixed with 20μg of COT Human DNA (Roche, 11 581 074 001) and 79μg of Salmon sperm DNA (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... Human periocular skin was digested in 2.4 U/ml dispase type II (Roche, Basel, Switzerland) at 4 °C for 12 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 ml of additional human dynein lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche) was added to the frozen cell pellet ...
-
bioRxiv - Cell Biology 2019Quote: ... 30 ml of additional human dynein lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche) was added to the frozen cell pellet ...
-
bioRxiv - Microbiology 2020Quote: ... according to the manufacturer’s instructions and ethanol precipitated with human Cot-1 DNA (Roche, Germany) and herring sperm DNA (Sigma Aldrich) ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Neuroscience 2023Quote: Recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche, Welwyn Garden City, UK) or placebo (PL ...
-
bioRxiv - Cancer Biology 2023Quote: ... and retrotranscribed cDNA quantified using the Universal Human Probe Roche library (Roche-Diagnostics, Barcelona, Spain). Assays were made in triplicate and normalized to TBP expression (ΔΔCT method) ...
-
bioRxiv - Genomics 2019Quote: The gDNA libraries were prepared using a SeqCap EZ Human Exome Library v2.0 (Roche, Basel, Switzerland). Sequencing was performed with 100-bp paired-end reads by the HiSeq2000 sequencer (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 ng of labeled probe was mixed with 10 μg of human Cot-1 DNA (Roche) and 10 μg each of salmon sperm DNA and E ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library (UPL) Probefinder software for human (Roche, version 2.53) or using previously published sequences and adjusted to be intron-spanning ...
-
bioRxiv - Immunology 2019Quote: For the in vitro cell stimulation and maintenance reagents were as follows: human IL-2 (Roche); IL-21 (PeproTech) ...
-
bioRxiv - Microbiology 2019Quote: ... Glutamax and Pen/Strep and with 100 U/mL recombinant human IL-2 (Roche; Sigma # 10799068001). For the analysis of reverse transcription products ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used for the immunostaining include human ERα rabbit monoclonal antibody (Roche Diagnostics, 790-4325), human PR rabbit monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regions to sequence were selected with the SeqCap EZ Human Exome Library v3.0 (Roche Applied Science) according to the manufacturer’s instructions and underwent 2 × 151 base-pair sequencing on Hiseq 4000 (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... the medium was supplemented with 30 IU/mL recombinant human interleukin 2 (IL-2) (Proleukin, Roche). Electroporated T cells were kept in culture ON and then used directly or frozen.
-
bioRxiv - Cancer Biology 2024Quote: ... were transfected into the human 293FT cell line using X-tremeGENE 9 DNA transfection reagent (Roche). After 48 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 20 mM HEPES) supplied with 30 U/ml of human recombinant IL-2 (rIL-2, Roche). Four domains of SUPT16H ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were resuspended in complete media plus 10 IU/mL recombinant human IL-2 (rHIL-2, Roche), and seeded in fresh media at 0.5×106 cells/mL every 48 hours ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Immunology 2021Quote: Total RNA was retrotranscribed and cDNA was quantified using the Universal Human Probe Roche library (Roche Diagnostics). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... and goat anti-human AF647 (Stratech 109-606-088- JIR)) DNA was then stained with DAPI (Roche) and coverslips mounted with Vectashield (Vector Laboratories - Vector H-1000).
-
bioRxiv - Immunology 2024Quote: Mice or Human CD4 T cells were lysed using RIPA buffer supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitors (Pierce) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...