Labshake search
Citations for Roche :
201 - 250 of 883 citations for VEGF C Human 196a.a HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-c-myc 9E10 (Roche, 11667203001); mouse monoclonal anti-FLAG M2 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2020Quote: ... alkylated and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Monoclonal anti–c-myc antibody was from Roche Applied Science (Indianapolis ...
-
bioRxiv - Physiology 2020Quote: ... on the Cobas C-501 autoanalyzer (Roche, Switzerland), and FFA levels were measured using a Wako Chemicals kit (Richmond ...
-
bioRxiv - Cell Biology 2021Quote: ... alkylated and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega)62,63 ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-c-myc-peoxidase (Roche, 11814150001; 1:10,000) and anti-HA-peroxidase (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes centrifugation at 13000 g at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes of centrifugation at 13000 g at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche, Switzerland). All primer sequences used in this study are listed in Supplementary materials (Supplementary Table S1).
-
bioRxiv - Microbiology 2022Quote: ... followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 s at 68 °C before final extension for 60 s at 68 °C) using the KAPA HiFi HotStart ready mix (KAPA Biosystems) before purification twice over 1X KAPA Pure beads (KAPA Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 s at 68 °C before final extension for 60 s at 68 °C) using the KAPA HiFi HotStart ready mix (KAPA Biosystems) before purification twice over 1X KAPA Pure beads (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... + 0,4 g/l of human albumin (Vialebex) with Liberase TL (Roche) 150 ug/ml and DNase 1 (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: Human Bax cDNA was cloned in a pIVEX 2.4 plasmid (Roche). The cloning was done so that the His6 tag was absent from the construction ...
-
bioRxiv - Genomics 2019Quote: ... using SeqCAP EZ Human Exome Library v3.0 (Roche NimbleGen, Madison, WI) for exome sequence capture ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mL human insulin (final concentration 20 μg mL-1, Roche), 1ml BSA (final concentration 50 μg mL-1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Immunology 2023Quote: ... and human rIL-2 (30 U/ml) (Roche/Merck, Darmstadt, Germany) to the culture ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing was performed using the SeqCap EZ Human Exome Library (Roche) and a NovaSeq 6000 sequencer (Illumina) ...
-
bioRxiv - Molecular Biology 2024Quote: Human genomic DNA of high molecular weight (Roche Diagnostics, Basel, Switzerland) were processed in a single replicate per DNA extraction protocol (Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... 45 cycles of 95°C for 3 s and 60°C for 30 s using the LightCycler 96 system (Roche, Basel, Switzerland) or the StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... pursued by 95°C for 3 minutes and then 45 cycles at 95°C for 15 seconds and 58°C for 30 seconds using a LightCycler 480 Real-Time PCR system (Roche, Rotkreuz, Switzerland). The primers and the probes were designed against the E gene (20).
-
bioRxiv - Immunology 2020Quote: ... cultured in vitro at 30 °C and at 37 °C in EMJH medium was also extracted using a High Pure RNA Isolation kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were incubated overnight at 4°C in Odyssey blocking buffer containing 0.1% Tween-20 at 4°C and 1/1000 dilution of anti-c-myc mouse monoclonal antibody (Catalogue number 11 667 149 007, Roche, Bâle, Switzerland) or anti-β-tubulin mouse antibody (Catalogue number T9026 ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted at 500 x g for 5 min at 4°C and resuspended in 10 ml 4 °C RSB supplemented with protease inhibitor (cOmpletetm, EDTA-free protease inhibitor cocktail, Roche, Cat#: 11873580001) and incubated on ice for 15min ...
-
bioRxiv - Neuroscience 2020Quote: DNA from the patient and his parents was extracted from 100 μl of EDTA-anticoagulated whole blood using MagNA Pure (Roche Diagnostics, West Sussex, UK) and used for subsequent analyses.
-
bioRxiv - Genomics 2020Quote: ... Paraffinized at 72°C with EZ solution (Roche Ventana). Antigen for SOX17 was retrieved via CC1 protocol with prediluted Tris solution ...
-
bioRxiv - Cell Biology 2019Quote: ... The anti-c-Myc antibody was purchased from Roche. Restriction enzymes and Gibson assemble master mix was purchased from New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 sec at 97°C in a LightCycler96 (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... and Proteinase K (Roche; 1 h at 55 °C) and DNA recovered using PCR purification kit (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR reactions were run for 50 cycles (95 °C for 15 s and 60 °C for 45 s) on a LightCycler 480 (Roche Diagnostics, Mannheim, Germany). Each sample was examined in three technical replicates and dissociation curves were analysed to verify the specificity of each amplification reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human samples using TriPure Isolation Reagent (Roche). RNA integrity (RIN ...
-
bioRxiv - Genomics 2022Quote: ... the regions of interest were PCR amplified from human genomic DNA (Roche) using Taq polymerase (Thermo Scientific ...
-
bioRxiv - Genetics 2023Quote: Candidate regions were PCR-amplified using human genomic DNA (Roche, Basel, Switzerland) as template and cloned in pGL4.23 Firefly luciferase reporter vector (Promega ...
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-mercaptoethanol and 10 ng/ml recombinant human IL-2 (Roche). Both human and murine CD4+ T cells were cultured for 46 hrs under humidified conditions at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... eosin and antibodies for human keratins AE1/AE3 (760-2135; Roche diagnostics). Metastasis quantification was reached through a review of 17 digitalized slides ...
-
bioRxiv - Developmental Biology 2021Quote: ... Probes were hybridized at 56°C overnight and subsequently detected by anti-DIG at 4°C overnight (1:1000; Roche 11-207-733-910) with secondary tyramide signal amplification for 2h at room temperature in the dark (AKOYA Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Cancer Biology 2020Quote: ... cooling: 37 °C for 30 s (LightCycler® 96, Roche). For relative quantification ...
-
bioRxiv - Cell Biology 2020Quote: ... iPSCs were cultured in iPSCs media over mitomycin C (Roche)-inactivated feeder cells ...
-
bioRxiv - Biophysics 2022Quote: ... C-33A cells were transiently transfected using FuGENE 6 (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Subsequent digestions with Endo-Protease Lys-C (Roche Diagnostics, USA) and trypsin (1:20 enzyme/protein ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary antibodies were c-Myc (monoclonal, from mouse, by Roche) and c-Myc (polyclonal ...
-
bioRxiv - Microbiology 2022Quote: ... Resuspended protein samples were digested with endoproteinases Lys-C (Roche) and trypsin (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37°C for 20 minutes and Proteinase K (Roche) overnight at 65°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) was used in the immunostaining assay.
-
bioRxiv - Cancer Biology 2021Quote: ... Pooled sample libraries were hybridized with SeqCap EZ Human Exome v3.0 probes (Roche) for WES ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 200 U/ml of recombinant human IL-2 (Roche, Nutley NJ, USA). All cell lines were grown in cell culture incubators at 37°C in the presence of 5% CO2.