Labshake search
Citations for Roche :
201 - 239 of 239 citations for Recombinant Human BMP4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Synthetic Biology 2019Quote: ... and the candidates were PCR amplified from a U2OS (human bone osteosarcoma cell line) genome prep as template with the Kapa Hifi Hotstart Polymerase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Developmental Biology 2021Quote: H9 human pluripotent stem cells were maintained in E8 media and passaged every four days onto matrigel-coated plates (Roche). ESCs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2023Quote: ... CD4+ T-cells were plated in 200ul of medium (RPMI, 10% human serum) containing IL-2 (Roche, 10 IU/mL) and IL-7 (Peprotech ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC), and liver (human hepatocellular carcinoma, HepG2) [45–50] cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: Cytotoxicity assays were performed as described29 (with minor changes. Proliferation of human cells was assessed using an MTT colorimetric assay (Cell Proliferation Kit I, Roche). HeLa (epithelial cells ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Immunology 2022Quote: ... The normalization of DNA amount was performed by quantifying albumin gene copies with qPCR using human genomic DNA (20 ng/µl) standard (Roche, #11691112001) as we previously described16.
-
bioRxiv - Microbiology 2019Quote: ... while all other specific primers were designed to be compatible with the Human Universal Probe Library set (90 probes, octamer, Roche Diagnostics) (Supplementary Table 9 ...
-
bioRxiv - Immunology 2019Quote: ... the wells were washed five times and incubated with 100 µl/well goat anti-human IgG conjugated with alkaline phosphatase (Roche Diagnostics) diluted 1 in 5,000 for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... adapter-ligated libraries were prepared with the KAPA Hyper Prep Kit and sequencing libraries were constructed using SeqCap EZ Human Exome Library v3.0 (Roche, Basel, Switzerland). Cluster generation was performed with the HiSeq PE Cluster Kit v4 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... then incubated for 30 min in Ringer solution before plating on fibronectin-coated glass coverslips (human plasma fibronectin at 10 µg/ml, Roche 10838039001).
-
bioRxiv - Microbiology 2021Quote: ... and washed once in cell lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche) prior to processing lysates ...
-
bioRxiv - Microbiology 2021Quote: ... falciparum 3D7 or HEK 293F cells were suspended in 1× pellet volume of lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Resuspended parasites were then transferred to a prechilled nitrogen cavitation chamber (Parr Instrument Company ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human samples were analyzed using a combination of gene-specific primers and Universal Probe Library (UPL) hydrolysis probes (Roche Life Science). Threshold cycle (Ct ...
-
bioRxiv - Neuroscience 2020Quote: Total proteins from mouse cerebella or human cerebellar cortex were obtained by lysis in RIPA buffer containing protease inhibitors (Complete, Roche Diagnostics), followed by sonication and centrifugation using an established protocol in the laboratory31 ...
-
bioRxiv - Neuroscience 2023Quote: ... prior to transfection with 2 μg pcDNA3.1 encoding N-terminally HA-tagged human 1N3R tau or 1N4R tau (14) using X-tremeGENE 9 (Roche Life Sciences), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... the T cells were activated in X-VIVO 15 containing 150 U/mL of human IL-2 (#Ro 23-6019, Roche, Switzerland), 10 ng/mL of recombinant IL-7 (#200-07 ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin-embedded human intestinal tissues was carried out on a Discovery Ultra automated slide stainer using a rabbit anti-human monoclonal antibody for CEA (Clone T84.66, Roche Glycart AG, Switzerland) at 2.23 µg/ml after antigen retrieval with Cell Conditioning 1 (CC1 ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were blocked in 10% BSA and 0.05% Tween 20 in PBS for 30 minutes before application of one of the following antibodies: mouse anti-human p16INK4a (CINTEC-Roche, cat# 705-4793), rabbit anti-human alpha-smooth muscle actin or aSMA (Abcam ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... HEK293 cells were transiently transfected with β-arrestin 2-Renilla luciferase 8 (Rluc8) and human C5aR2-Venus constructs using XTG9 (Roche, Sydney, Australia) for 24 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... frozen human samples were disrupted in 600 µl of lysis buffer containing green ceramic beads using the MagNA Lyser Instrument (Roche Life Science, Germany). The cDNA synthesis was performed in a 20-µl reaction using random hexamers ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of beta-globin was performed by a commercially available human genomic DNA kit (The LightCycler Control Kit DNA, Roche Diagnostics, Basel, Switzerland)69.