Labshake search
Citations for Roche :
201 - 250 of 5086 citations for QuantiFluo Ammonia Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and Kapa Illumina Library Quantification qPCR assays (Kapa Biosystems). Individually indexed libraries were pooled and 50 bp ...
-
bioRxiv - Cancer Biology 2021Quote: ... RIPA (radioimmunoprecipitation assay) along with complete proteinase (Roche, Basel, Switzerland) and phosphatase inhibitors mixture (Calbiochem ...
-
bioRxiv - Immunology 2022Quote: ... and the following RealTime ready Single Assays (Roche, Basel, Switzerland) for IDO1 (#100134768) ...
-
bioRxiv - Bioengineering 2019Quote: ... WST-1 cell proliferation assay reagent was purchased from Roche Diagnostics GmbH (Mannheim ...
-
bioRxiv - Cancer Biology 2021Quote: ... TUNEL assays were performed according to the manufacturer’s instructions (Roche). Following treatment ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was measured using an MTT assay (Roche Diagnostics), and the synergistic effect of cisplatin and SB265610 assessed on the Compusyn Software (Combosyn Inc.) ...
-
bioRxiv - Microbiology 2021Quote: DNA for use in the qPCR assay (LightCycler 96, Roche) was extracted using the GenElute Bacterial Genomic DNA kit (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... TUNEL assay was performed according to manufacturer’s instructions (Roche, 11684795910). In brief ...
-
bioRxiv - Microbiology 2020Quote: Cell proliferation was measured using the WST-1 Assay (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Proliferation was quantified by the colorimetric BrdU assay (Roche, Germany). Toxicity was assessed using the ToxiLight™ Non-destructive Cytotoxicity BioAssay Kit (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: TUNEL assay was performed according to manufacturer’s instructions (Roche, 11684795910). In brief ...
-
bioRxiv - Microbiology 2020Quote: ... All qPCR assays were performed in a LightCycler480 (Roche Diagnostics) apparatus ...
-
bioRxiv - Developmental Biology 2022Quote: ... Filters were subjected to a chemiluminescent assay using CSPD (Roche) as a substrate and exposed to Kodak X-ray film ...
-
bioRxiv - Microbiology 2022Quote: ... SYBR green assays (FastStart universal SYBR green master mix; Roche or Thunderbird SYBR qPCR master mix ...
-
bioRxiv - Neuroscience 2023Quote: ... The SYBR Green-based assay (SYBR Green I Master, Roche) with a two-step cycling protocol was used for the gene expression analysis using LightCycler 480 (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: Cell adhesion assay was performed using xCELLigence RTCA instrument (Roche). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... qPCR assays were performed using the LightCycler 96 system (Roche), KAPA SYBR FAST qPCR kit (Nippon Genetics ...
-
bioRxiv - Cell Biology 2024Quote: ... monosodium salt (WST-1 assay) (Roche, Manheim, Germany, Cat. #5015944001) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The qPCR assays were carried out in a LightCycler96 system (Roche), using MESA BLUE qPCR kit for SYBR assay (Eurogentec ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed using Sybr green-based assay (Roche, Indiana, USA) using IDT primers (IDT technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... performed according to the manufacturer’s instructions (Roche - TeloTAGGG telomere length assay). The protocol involved DNA fragmentation using a combination of the frequently cutting restriction enzymes Hinf1 and Rsa1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... TaqMan assays and Universal Probe Library (UPL) probes (Roche Molecular Systems) were used to perform gene quantification.
-
bioRxiv - Immunology 2021Quote: ... Assays were performed with Kapa SYBR Fast qPCR master mix (Roche) and mRNA expression levels of Crtc2 and Prdm1 were quantified with standard curves and results were normalized to the expression of Rps18 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 μl of 2X kinase assay buffer containing 40μM ATP (Roche) was added to the tubes and 10μg equivalent of corresponding lysate was added ...
-
bioRxiv - Cell Biology 2021Quote: C2C12 cell proliferation was measured using the WST1 colorimetric assay (Roche). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... Cytotoxicity of the compounds was assessed using the MTT assay (Roche) in uninfected cells treated with the same compound dilution and concurrent with the viral replication assay.
-
bioRxiv - Cell Biology 2022Quote: ... gene expression assays on a Roche Lightcycler 480 (Roche, Basel, Switzerland) using standard protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Assays were done using a LightCycler® 480 (Roche Applied Science) and the following conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... qPCR was performed using Sybr green-based assay (Roche, Indiana, USA) using IDT primers (IDT technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... qRT-PCR assays were performed on the LightCycler 480 System (Roche).
-
bioRxiv - Cell Biology 2020Quote: WST-1 assay was employed to measure proliferation rates (Roche, Switzerland). Cells were seeded at a density of 1000 cells per well in 96-well plates one day prior to transfection ...
-
bioRxiv - Microbiology 2022Quote: ... This assay was performed on a LightCycler 480 (Roche, Basel, Switzerland).
-
bioRxiv - Microbiology 2022Quote: ... and qPCR assays were carried out in a LightCycler96 system (Roche), using MESA BLUE qPCR kit for SYBR assay (Eurogentec ...
-
bioRxiv - Microbiology 2022Quote: ... HBeAg was detected using the Elecsys HBeAg assay (Roche, Meylan, France). Lumipulse® G HBcrAg assay (Fujirebio ...
-
bioRxiv - Molecular Biology 2022Quote: ... ATP concentration was determined by ATP bioluminescence assay (Roche, Tucson, AZ) following the manufacturers’ instructions ...
-
bioRxiv - Immunology 2023Quote: ... glucose were measured by automated enzymatic colorimetric assay (Cobas, Roche, Germany). The area under the curve (AUC ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the Luciferase Reporter Gene Assay according to manufacturer’s instructions (Roche). Hep3B cells were stimulated with human IL-6 (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2023Quote: MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Glycogen assays (Pointe Scientific G7521-500, Roche 10102857001, Thermo Sci J16445-06), triglyceride assays (Pointe Scientific T7532-120 ...
-
bioRxiv - Cancer Biology 2020Quote: Cell viability was evaluated using the colorimetric WST-1 assay (Roche Diagnostics). After a 4-h incubation period with WST-1 reagent the absorbance was measured at 450 nm/ 600 nm using a microplate reader (ELISA-Reader Zenyth 200st ...
-
bioRxiv - Cancer Biology 2020Quote: ... Q-PCR was performed with SYBR green-based gene expression assays (Roche). Primer sequences are available on request.
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Centre (Roche), compatible with UPLs 157 (ActB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... And then qPCR assays were performed on the LightCycler 480 II (Roche) in 10μL reaction volume containing 6μL of SYBR green Master mix (Fisher Scientific A25918) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was measured by WST-1 assay following manufacture’s protocol (Roche). The IC50 and CC50 were calculated using a four-parameter logistic regression model from the GraphPad Prism 5 software (GraphPad Software Inc.).
-
bioRxiv - Bioengineering 2021Quote: Primers were designed using the Universal Probe Library Assay Design Center (Roche) and checked for specificity against the Physcomitrella transcriptome in the Phytozome database (Goodstein et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The assay was followed according to the manufacturers protocol (Roche Applied Science).
-
bioRxiv - Cell Biology 2021Quote: ... Te assay was performed according to the instructions of the vendor (Roche). The population doubling time was computed as the ln(2)/slope of the proliferation growth curve using Prism software ...
-
bioRxiv - Biochemistry 2022Quote: ... TUNEL assay was carried out according to manufacturers instructions (Roche Diagnostics, IN). Primary antibodies were visualized with species-specific secondary antibodies conjugated to fluorescent probes ...
-
bioRxiv - Biophysics 2022Quote: ... Cytotoxicity was also performed at matched concentrations using the MTT assay (Roche), according to the manufacturer’s instructions ...