Labshake search
Citations for Roche :
201 - 250 of 1121 citations for Dopamine Transporter Rat Monoclonal DAT ECD biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-HA 3F10(Roche), and fluorescence-conjugated secondary antibodies (Jackson Laboratories)(1:300).
-
bioRxiv - Cell Biology 2021Quote: ... rat anti-HA 3F10 (Roche) and mouse anti-FLAG M2 (Sigma).
-
bioRxiv - Microbiology 2022Quote: ... and rat anti-HA (Roche) antibodies diluted 1:500 in 1 U/mL DNAse I in Tris Buffered Saline containing 1% BSA (GE Healthcare) ...
-
bioRxiv - Microbiology 2019Quote: ... rat α HA (Roche 3F10) was used and for AP2-I-GFP rabbit α GFP (Abcam ab290 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Roche Diagnostics), mouse anti-HA (Covance) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-HA (rat, 11867423001; Roche), anti-YIPF4 (rabbit ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rat anti-HA (Roche, Basel ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat-anti-HA (3F10, Roche, 11867423001 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rat anti-HA (Roche) 1:250 ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylated human MIF was produced using D-biotinoyl- ε -aminocaproic acid-N-hydroxy-succinimide ester (Biotin-7-NHS) with the Biotin Protein Labeling Kit from Roche (Mannheim, Germany). Alternatively ...
-
bioRxiv - Cell Biology 2021Quote: ... monoclonal anti-GFP antibody (Roche) and polyclonal antibody raised against Erg6 (kind gift from G ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal anti-HA (3F10, Roche), and monoclonal anti-tubulin (DM1A ...
-
bioRxiv - Plant Biology 2022Quote: ... and anti-GFP (Roche; monoclonal) antibodies were used to evaluate the abundance of PM H+-ATPase ...
-
bioRxiv - Cell Biology 2024Quote: ... The membrane was blotted with anti-GFP monoclonal primary antibody (mouse monoclonal, Sigma- Roche #11814460001) at 4°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... pre-hybridized and hybridized with a biotin-16-dUTP (Roche) labeled dsDNA probe including the whole 3’UTR and generated using detailed primers (Bidet et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.5mM biotin-16-UTP (Roche Life Science, Penzberg, Germany) as previously described (37) ...
-
bioRxiv - Microbiology 2023Quote: ... and a biotin RNA labeling mix (cat. no. 11685597910, Roche). To create a 20 μl reaction volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... mRNA probes labeled with digoxigenin-UTP (Roche) were synthesized from 1 μg of the above PCR product using the ampliCapTM SP6 high-yield message marker kit (Cell Script).
-
bioRxiv - Molecular Biology 2020Quote: ... Digoxygenin (DIG)-labeled DNA probes (Roche, Germany) were generated by PCR according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and screened it using DIG-labeled (Roche) PCR probes to the center of the FLC locus (primers 5’ AGTGTAACTTCAATGGCAGAAAACCCT 3’ and 5’ ATGTGGCGGTAAGCAGAGATGACC 3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... and digoxygenin- or fluorescein-labeled nucleotides (Roche), and hydrolyzed to around 500 bp if needed ...
-
bioRxiv - Genomics 2019Quote: ... Digoxigenin (DIG) labeled nucleotides (Roche, Basel, Switzerland) were used to create amplified sequences with DIG labeled base pairs ...
-
bioRxiv - Developmental Biology 2023Quote: ... and digoxigenin or fluorescein labeled nucleotides (Roche). In situ hybridization was carried out using standard protocols (74) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and digoxigenin (DIG)-labeled NTPs (11277073910, Roche) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA-clone 3F10 (Roche), mouse anti-Myc monoclonal 4A6 (EMD Millipore) ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (Roche, clone 3F10) (200 pg/ml) ...
-
bioRxiv - Plant Biology 2019Quote: ... rat α-HA (all from Roche), and α-FLAG (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: α-HA rat mAb (1/1,000) (Roche) as primary antibody ...
-
bioRxiv - Synthetic Biology 2021Quote: ... rat anti-HA clone 3F10 (Roche) at a dilution of 1:1000 for SGR57 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (1:250; Roche), mouse anti-CD63 (E-12 ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-HA (Roche, Basel, Switzerland), mouse anti-GFP (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-HA (1:1000, Roche) The following secondary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... Rat anti-HA antibody (Roche 3F10) was used at 1:2,000 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... Rat anti-HA (1:100; Roche), mouse anti-GFP-20 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-HA (1:200, Roche), mouse anti-Flag (1:500 ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-HA (Roche, 1:1,000) and mouse anti-α-tubulin (12G10 clone ...
-
bioRxiv - Cell Biology 2022Quote: ... and rat anti-HA antibody (Roche). The release to mitosomal proteins was quantified by ImageJ (86).
-
bioRxiv - Immunology 2022Quote: ... rat-anti-HA (clone 3F10, Roche cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-HA (Rat, #11867423001 Sigma Roche), anti-Dan (Rabbit ...
-
bioRxiv - Plant Biology 2023Quote: ... rat α-HA (Hoffmann-La Roche AG ...
-
bioRxiv - Cell Biology 2023Quote: ... rat a-HA (1:2000) (Roche), rabbit anti-aldolase (1.2000 ...
-
bioRxiv - Genomics 2023Quote: ... Rat anti-HA antibody (Roche 3F10) was used at 1:2,000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... HA (11867423001, Roche, rat, 1:1000); HA (sc-7392 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-HA (Roche, rat, 1:1000), anti-Vps18 (Abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti-HA (1:1000, Roche), rat anti-E-cadherin (1:10 ...
-
bioRxiv - Cell Biology 2023Quote: ... rat anti-HA tag (Roche, 11867432001), rabbit anti-FAM134B (Sigma Prestige ...
-
bioRxiv - Microbiology 2023Quote: ... rat anti-HA (1:2500; Roche), mouse anti-Ty52 (1:10000 ...
-
bioRxiv - Genetics 2024Quote: ... rat anti-HA (Clone 3F10, Roche) at 1:50 ...
-
bioRxiv - Genetics 2023Quote: ... rat anti-HA (Roche, 1:50), mouse anti-C(3)G (1:500 ...
-
bioRxiv - Plant Biology 2022Quote: ... Tagged SAC9 fusion proteins were revealed by using GFP monoclonal antibody (anti-GFP mouse monoclonal, Roche) and detected by chemiluminescence using ECL revelation as for T-PLATE and SH3P2 fusion proteins.