Labshake search
Citations for Roche :
201 - 250 of 1255 citations for 7 CYANO 4 HYDROXY 3 QUINOLINECARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... NimbleGen 4-plex arrays containing 4 × 72,000 arrays per slide were used (Roche, Mannheim, Germany). Construction of this chip was initially based on combining two previous genome annotations (Amselem et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg of plasmid and 4 μl of X-tremeGENE HP DNA Transfection Reagent (Roche) were used per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... in Tris calcium buffer with ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche) were added and the pellet resuspended ...
-
bioRxiv - Genetics 2021Quote: ... with the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Total RNA was isolated via MPLC Total Nucleic Acid Isolation Kit (Roche) using automated MagNA Pure LC Instrument (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... pH 8.0) supplemented with ethylenediaminetetraacetic acid and cOmplete protease inhibitor cocktail (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2019Quote: ... Slides were then blocked with 0.5% nucleic acid blocking reagent (Roche 11096176001) dissolved in a 1x PBS containing maleic acid (Sigma M0375 ...
-
bioRxiv - Genetics 2020Quote: ... acid-extracted histones were digested with Asp-N and Arg-C (Roche) and the resulting digests were analyzed by chromatography on an Ultimate 3000 nanoLC (Dionex ...
-
bioRxiv - Microbiology 2020Quote: Escherichia coli MRE600 total transfer ribonucleic acid was purchased from Roche (Switzerland). Biotin labeled single-stranded DNA oligonucleotides were obtained from B.G.I. ...
-
bioRxiv - Genetics 2023Quote: ... 1×EDTA (Ethylene Diamine Tetraacetic Acid)-free protease inhibitor cocktail (Roche 04693132001). The larvae were then crosslinked by adding formaldehyde to a 1.8% concentration and incubating for 5mins at RT on a rotator ...
-
bioRxiv - Neuroscience 2024Quote: ... ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablets (plus protease inhibitors) (Roche). For experiments where separate measurements were made in ganglia versus neurites ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... in deionized phosphate-buffered saline (PBS)] supplemented with 1:7 proteases inhibitors cocktail (Roche Diagnostics GmBH, Germany) for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg sequencing grade trypsin (Roche) was dissolved in 165 μL ice cold trypsin digestion buffer and added to resin in the spin columns with the bottom capped ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 8.0) supplemented with one tablet ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche). The cell solution on ice was sonicated 3 × 1 min at 90% amplitude (0.5 s cycles ...
-
bioRxiv - Molecular Biology 2021Quote: ... and supplemented with an ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablet (Roche). Cells were lysed via high-pressure homogenization ...
-
bioRxiv - Genomics 2019Quote: ... 5.6mmol/L glucose with 2% BSA fraction V fatty acid free (Roche Diagnostics), 50μmol/L 2-mercaptoethanol ...
-
bioRxiv - Neuroscience 2021Quote: ... viral DNA was purified from SN (High Pure Viral Nucleic Acid Kit, Roche) and PCR was set up with Brilliant II qPCR Low ROX Master Mix (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from a 200µL sample using the MagnaPure24 (Roche) External Lysis Pathogen 200 protocol with elution into 50 µL ...
-
bioRxiv - Microbiology 2022Quote: Viral DNA was extracted by the High Pure Viral Nucleic Acid Kit (Roche) and eluted in 40 μM (μL ...
-
bioRxiv - Cell Biology 2020Quote: ... supernatant removed and ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail (Roche, Lewes, UK) added to cell-free media ...
-
bioRxiv - Pathology 2023Quote: ... 0.1% SDS and 0.5% deoxycholic acid) with cocktail protease and phosphatase inhibitors (Roche) at 4℃ condition ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM ethylenediaminetetraacetic acid (EDTA)) supplemented with an EDTA-free antiprotease tablet (Roche) and lysed by sonication ...
-
bioRxiv - Cell Biology 2023Quote: ... Basal respiration was measured in DMEM containing 2% fatty-acid-free BSA (Roche). Cells were treated with 100 μM isoproterenol to stimulate respiration ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 2% bovine serum albumin (BSA; fraction V, fatty-acid-free; Roche), 50 µM β-mercaptoethanol (Sigma) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were indexed using KAPA Unique Dual-Indexed Adapter Kit at 7 µM (KK8727, Roche Life Science) and 7 cycles of PCR library amplification were used ...
-
bioRxiv - Microbiology 2019Quote: ... cells were harvested at 0 to 7 DPI in RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche). Protein concentrations were determined by bicinchoninic acid (BCA ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA extracted from the parasites at passages 7 and 20 were digested with 5 U Rsa1 (Roche) at 37 °C overnight ...
-
bioRxiv - Physiology 2024Quote: ... from two bees were pooled and homogenized in 250 µL of phosphate-buffered saline (7 mM NaCl, 2.7 mM KCl, and 10 mM PO4, pH 7.4) containing cOmplete protease inhibitors (Roche) at kept on ice until further processing ...