Labshake search
Citations for Roche :
201 - 250 of 2285 citations for 6 Chloro 3 imino 2 3 dihydropyridazine 2 acetic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Immunology 2019Quote: ... diluted 1:150 in washing buffer (45 min) and 4’,6-diamidino-2-phenylindole counterstain (DAPI; Roche/Sigma-Aldrich) diluted 1:250 in TBS (15 min ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... Fluorescent counterstaining of cell nuclei was carried out in a PBS solution with 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals ...
-
bioRxiv - Physiology 2020Quote: Islets were isolated from male C57BL/6 mice at 2 to 4 month of age using Collagenase P (Roche Diagnostics ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were cotransfected with 4 μg of Env-deficient HIV-1 proviral plasmid (Q23ΔEnvGFP) and 2 μg of HIV-1 Env clone of interest using Fugene 6 transfection reagent (Roche) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... After washes, the cells were stained with the DNA stain DAPI (4, 6 diamidino-2-phenylindole dihydrochloride) (Roche, #1023627001) and mounded with Prolong gold anti-fade mound media (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... and RIPA double-detergent buffer (2% deoxycholate, 2% NP40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with a protease-inhibitor cocktail (Roche). Cells were subsequently incubated on ice for 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... and RIPA double-detergent buffer (2% deoxycholate, 2% NP-40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with protease inhibitor cocktail (Roche), as described previously (Kemaladewi et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM MgCl2, 2 mM DTT, 2 µM leupeptin, 2 mM PMSF, 250 mM sucrose, and 1× PhosSTOP phosphatase inhibitors [Roche]). The homogenate was centrifuged for 15 min at 10,000 × g at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 mM Tris(2-carboxyethyl)phosphine (TCEP) and cOmplete protease inhibitors (Roche). Cells were lysed by sonication and cell debris pelleted at 25,000 rpm for 40 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM Mg(OAc)2 supplemented with phosphatase and protease inhibitors (Roche) (adapted from (29)) ...
-
bioRxiv - Cell Biology 2020Quote: ... L6 cells and cardiomyocytes by incubating them in their respective media containing 2% (w/v) fatty acid-free bovine serum albumin (FAF-BSA; Roche) and 0.4 mM sodium palmitate (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... medium was replaced with E6 medium (DMEM/F-12 supplemented with 64 mg/L L-ascorbic acid 2-phosphate magnesium, 14 µg/L sodium selenium, 543 mg/L sodium bicarbonate, mg/L insulin [Roche, Penzberg ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were incubated for 1 hour in TBST and then in Blocking Buffer (2% blocking reagent in maleic acid buffer pH 7.5 (Roche, #11096176001) and 10% sheep serum (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2% blocking reagent (Roche), 20% heat inactivated goat serum and then incubated overnight with anti-DIG antibody (Roche ...
-
bioRxiv - Biochemistry 2020Quote: For Figures 2 and 6: Cells or embryos were lysed in RIPA buffer supplemented with a cocktail of protease inhibitor (Roche). Total protein was resolved on SDS polyacrylamide gels (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: T98G cell pellets were fixed by dropwise addition of cold 70% ethanol and their DNA was stained with 4’,6-diamino-2-phenylindole (1 μg/ml, Roche), 0.1% Triton X-100 in phosphate-buffered saline (PBS) ...
-
bioRxiv - Plant Biology 2022Quote: ... Glucose content was then measured by spectrophotometry after a 2 enzymes reaction with hexokinase and glucose-6-phosphate dehydrogenase (Roche).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Neuroscience 2023Quote: ... diluted in PBS for 2 hours at room temperature after which they were counterstained with 300 nM 4’,6’-diamino-2-phenylindole (DAPI; 10236276001, Roche) for 5 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... The primary antibodies and respective concentrations used in this study are the following: 4’,6-diamidino-2-phenylindole (DAPI) (1:500, Roche), anti-Ki67 (1:100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... and recombinant mouse interleukin-2 (mIL-2, 100 U/ml; Roche, Basel, Switzerland), and subjected to flow cytometry as described elsewhere ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3× EDTA-free complete protease inhibitor cocktail (Roche). Lysates were briefly sonicated until the protein solution was clear ...
-
bioRxiv - Cancer Biology 2022Quote: ... incubated with blocking buffer containing 3 % BSA (Roche Diagnostics), 5 % goat serum (Jackson ImmunoResearch Laboratories) ...
-
bioRxiv - Neuroscience 2020Quote: Clonazepam (CAS #1622-61-3) was bought from Roche on 2018 ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 7.2 ...
-
bioRxiv - Biophysics 2024Quote: ... 20 mM imidazole) supplemented with 3 protease inhibitors (Roche) and then lysed by an EmulsiFlex-C3 (Avestin ...
-
bioRxiv - Neuroscience 2023Quote: ... 150 μL of RIPA double-detergent buffer (2% deoxycholate, 2% NP-40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with protease inhibitor cocktail (Roche, cat# A32953) was added to the tissue homogenate followed by incubation on a shaker for 1 h at 4ºC ...
-
bioRxiv - Cell Biology 2024Quote: ... just after the resection the tissue was dissociated into small pieces (∼2 mm × 2 mm × 2 mm) and then digested for 30 minutes at 37°C with Collagenase (2 mg/mL, Roche, Basel, Switzerland) and DNase I (400 U/mL ...