Labshake search
Citations for Roche :
201 - 250 of 966 citations for 6 Bromo benzo c isothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-c-myc 9E10 (Roche, 11667203001); mouse monoclonal anti-FLAG M2 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2020Quote: ... alkylated and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Monoclonal anti–c-myc antibody was from Roche Applied Science (Indianapolis ...
-
bioRxiv - Physiology 2020Quote: ... on the Cobas C-501 autoanalyzer (Roche, Switzerland), and FFA levels were measured using a Wako Chemicals kit (Richmond ...
-
bioRxiv - Cell Biology 2021Quote: ... alkylated and digested with endoproteinase Lys-C (Roche) followed by modified trypsin (Promega)62,63 ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-c-myc-peoxidase (Roche, 11814150001; 1:10,000) and anti-HA-peroxidase (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes centrifugation at 13000 g at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... at 4°C with protease inhibitors cocktail (Roche). After 20 minutes of centrifugation at 13000 g at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche, Switzerland). All primer sequences used in this study are listed in Supplementary materials (Supplementary Table S1).
-
bioRxiv - Microbiology 2022Quote: ... followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 s at 68 °C before final extension for 60 s at 68 °C) using the KAPA HiFi HotStart ready mix (KAPA Biosystems) before purification twice over 1X KAPA Pure beads (KAPA Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 s at 68 °C before final extension for 60 s at 68 °C) using the KAPA HiFi HotStart ready mix (KAPA Biosystems) before purification twice over 1X KAPA Pure beads (KAPA Biosystems) ...
-
bioRxiv - Biophysics 2019Quote: ... 6 μg of Prc was incubated with 0.6 μg of V8 protease (Roche) in 0.1 M Tris (pH 7.4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was measured 6 days post transfection using WST-1 reagent (Roche). Cells were incubated with 10 μl of WST-1 per 100 μl of media for 1 hour and absorbance was read at 450 and 630 nm ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μl of 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, Washington, USA), 1.4 μl of each primer (2.5 μM) ...
-
bioRxiv - Plant Biology 2021Quote: ... with gene-specific primers (Supplementary Table 6) on a LightCycler 480 system (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Tumors were transferred into 6-well plates containing 0.25mg/mL LiberaseTL (Roche, 5401020001) and 0.33mg/mL DNase (Sigma-Aldrich DN25-10MG ...
-
bioRxiv - Neuroscience 2022Quote: Recombinant lentiviruses were produced by transfecting HEK293T cells using FuGENE®6 (Roche) with plasmids encoding viral enzymes and envelope proteins essential for packing of viral particles (pRSV-EV ...
-
bioRxiv - Molecular Biology 2023Quote: ... were stained overnight with 4′,6-diamidino-2-phenylindole (DAPI, Roche, Basel, Switzerland) at a final concentration of 5 µg ml-1 ...
-
bioRxiv - Genomics 2023Quote: ... 6 μL of Ligation-1 mix (3.75 U T4 DNA ligase (Roche, 10799009001), 33.3 mM DTT (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... with 6-8 cycles of PCR amplification using KAPA-HiFi (Kapa Biosystems, KK2602). DNA library was sequenced using an Illumina NextSeq 500 75-cycle high output kit.
-
bioRxiv - Microbiology 2023Quote: ... Pools of 6 ganglia were homogenized in 1 ml TriPure isolation reagent (Roche) using lysing matrix D on a FastPrep24 instrument (3 cycles of 40 seconds at 6 m/s) ...
-
bioRxiv - Microbiology 2023Quote: ... Pools of 6 ganglia were homogenized in 1 ml TriPure isolation reagent (Roche) using lysing matrix D on a FastPrep24 instrument (3 cycles of 40 seconds at 6 m/s) ...
-
bioRxiv - Microbiology 2022Quote: ... 45 cycles of 95°C for 3 s and 60°C for 30 s using the LightCycler 96 system (Roche, Basel, Switzerland) or the StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... pursued by 95°C for 3 minutes and then 45 cycles at 95°C for 15 seconds and 58°C for 30 seconds using a LightCycler 480 Real-Time PCR system (Roche, Rotkreuz, Switzerland). The primers and the probes were designed against the E gene (20).
-
bioRxiv - Immunology 2020Quote: ... cultured in vitro at 30 °C and at 37 °C in EMJH medium was also extracted using a High Pure RNA Isolation kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were incubated overnight at 4°C in Odyssey blocking buffer containing 0.1% Tween-20 at 4°C and 1/1000 dilution of anti-c-myc mouse monoclonal antibody (Catalogue number 11 667 149 007, Roche, Bâle, Switzerland) or anti-β-tubulin mouse antibody (Catalogue number T9026 ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted at 500 x g for 5 min at 4°C and resuspended in 10 ml 4 °C RSB supplemented with protease inhibitor (cOmpletetm, EDTA-free protease inhibitor cocktail, Roche, Cat#: 11873580001) and incubated on ice for 15min ...
-
bioRxiv - Genomics 2020Quote: ... Paraffinized at 72°C with EZ solution (Roche Ventana). Antigen for SOX17 was retrieved via CC1 protocol with prediluted Tris solution ...
-
bioRxiv - Cell Biology 2019Quote: ... The anti-c-Myc antibody was purchased from Roche. Restriction enzymes and Gibson assemble master mix was purchased from New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 4 °C overnight and protein G-Agarose (Roche) at 4 °C for 3 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 sec at 97°C in a LightCycler96 (Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... and Proteinase K (Roche; 1 h at 55 °C) and DNA recovered using PCR purification kit (Qiagen).
-
bioRxiv - Genomics 2019Quote: ... Index tagged samples were amplified (6 cycles of PCR, KAPA HiFi kit, KAPA Biosystems), quantified (Accuclear dsDNA Quantitation Solution ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 6 M urea) in the presence of protease and phosphatase inhibitor cocktails (Roche). Mechanical homogenization of the tissue was performed using a Precellys 24 tissue homogenizer (Bertin Instruments ...
-
bioRxiv - Cell Biology 2019Quote: ... Tissues were incubated with secondary antibodies plus DAPI (4’,6-diamidino-2-phenylindole; Roche) at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole; 10236276001, Roche, Basel, Switzerland) for 5 minutes at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... The glucose released was measured using the hexokinase/glucose-6-phosphate dehydrogenase method (Roche). Starch content (in glucose equivalents ...
-
bioRxiv - Plant Biology 2023Quote: ... and released glucose was assayed using the hexokinase/glucose-6-phosphate dehydrogenase assay (Roche).
-
bioRxiv - Biochemistry 2023Quote: ... DNA was stained using DAPI (4′,6-diamidino-2-phenylindol-dihydrochloride) (Roche, Mannheim, Germany). Slides were examined using an Axio Imager 7.1 microscope (Zeiss ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche, 10236276001; 1:10,000) for 5 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM 2-Mercaptoethanol and 6 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 8.0) ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA vectors were transfected using FuGENE 6 transfection reagent (Roche Applied Science, Laval, QC) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR reactions were run for 50 cycles (95 °C for 15 s and 60 °C for 45 s) on a LightCycler 480 (Roche Diagnostics, Mannheim, Germany). Each sample was examined in three technical replicates and dissociation curves were analysed to verify the specificity of each amplification reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Probes were hybridized at 56°C overnight and subsequently detected by anti-DIG at 4°C overnight (1:1000; Roche 11-207-733-910) with secondary tyramide signal amplification for 2h at room temperature in the dark (AKOYA Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Cancer Biology 2020Quote: ... cooling: 37 °C for 30 s (LightCycler® 96, Roche). For relative quantification ...
-
bioRxiv - Cell Biology 2020Quote: ... iPSCs were cultured in iPSCs media over mitomycin C (Roche)-inactivated feeder cells ...
-
bioRxiv - Microbiology 2019Quote: ... Subsequent digestions with Endo-Protease Lys-C (Roche Diagnostics, USA) and trypsin (1:20 enzyme/protein ratio ...