Labshake search
Citations for Roche :
201 - 250 of 2922 citations for 5 FLUORO 2 PHENYLBENZO D THIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Chlorophenol red-beta-D-galactopyranoside (Roche Diagnostics, Indianapolis, IN) substrate was added to cell lysates ...
-
bioRxiv - Cancer Biology 2022Quote: ... and digested with 1 mg/ml collagenase D (Roche) and 100 µg/ml DNase I (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and collagenase D at 400 U ml-1 (Roche). After digestion ...
-
bioRxiv - Immunology 2023Quote: ... and collagenase D at 400 U ml-1 (Roche). pLNs were cut into small pieces and incubated for 30 min at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with collagenase D (1 mg ml−1, Roche) and DNase I (0.25 mg ml−1 ...
-
bioRxiv - Cell Biology 2023Quote: ... and collagenase D (1 mg/mL; Roche, Basel, Switzerland) [9] ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with collagenase D (1 mg/ml; Roche) in RPMI1640 medium at 37 °C for 30 min ...
-
bioRxiv - Immunology 2023Quote: ... enzymatic dissociation with 1 μg/ml Collagenase D (Roche) and 25 μg/mL DNAse I (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... followed by enzymatic digestion with collagenase D (Roche 11088882001). Cells were passed through a 70 µm cell strainer ...
-
bioRxiv - Neuroscience 2024Quote: ... and collagenase D (1.4 mg/ml, Roche Life Science). After 40-min incubation under constant shaking at 34°C ...
-
bioRxiv - Immunology 2023Quote: ... and incubated with 1 mg/ml collagenase D (Roche) and 0.1 mg/ml DNase I (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Immunology 2020Quote: ... 1.7 mM chlorophenol red-β-D-galactopyranoside (CPRG, Roche #10884308001). CPRG conversion by β-galactosidase was measured by optical density at 590 nm.
-
bioRxiv - Cell Biology 2019Quote: ... Muscle were digested with 2.5 mg/ml Collagenase D (Roche) and 0.04 U/ml Dispase II (Roche ...
-
bioRxiv - Immunology 2019Quote: ... homogenized and digested with collagenase D (2.5 mg/ml, Roche), DNAse I (100 μg/ml ...
-
bioRxiv - Bioengineering 2019Quote: ... with 1 mg/mL of Collagenase D (Roche, Basel, Switzerland) and 0.1 mg/mL DNase I (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... for 25 min and collagenase D (1 mg/mL, Roche) with papain (30 U/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by collagenase D (3 mg/mL, COLLD-RO, Roche) two times at 37 degrees ...
-
bioRxiv - Immunology 2022Quote: ... Meninges were digested with Collagenase D (Cat:11088858001, Roche, Germany) and DNase I (Cat:10104159001 ...
-
bioRxiv - Developmental Biology 2019Quote: Postnatal thymi were dissociated in 1.25mg/ml collagenase D (Roche), and subsequently in 1.25mg/ml collagenase/dispase (Roche ...
-
bioRxiv - Immunology 2020Quote: ... Digestion was performed with a 0.1% collagenase D (Roche;11088866001) and 0.2% trypsin solution (Gibco;15090-046 ...
-
bioRxiv - Immunology 2020Quote: ... Lymph nodes were treated with collagenase D (Roche, Basel, Switzerland) and DNase I (Boehringer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.5 ml of Collagenase D (Roche, #11088866001, 1:10 dilution) and DNAseI (Stemcell #07900 ...
-
bioRxiv - Microbiology 2023Quote: ... TE Select-D G-25 spin columns (Roche Applied Science) were used to remove unincorporated [μ-32P]dATP ...
-
bioRxiv - Bioengineering 2023Quote: ... a protease solution of 2.5 mg/mL collagenase D (Roche) in PBS was prepared and added to cover the samples before incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3.7U collagenase D (Roche, cat 11 088 882 001) via inferior vena cava ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM Imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM Imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Developmental Biology 2021Quote: ... Planarians were blocked in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx [0.1 M Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... transferrin (5 μg/mL) and sodium selenite (5 ng/mL) (Roche Diagnostics, Germany), 100 units/mL of penicillin ...
-
bioRxiv - Developmental Biology 2023Quote: ... Planarians were blocked in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx [0.1 M Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...