Labshake search
Citations for Roche :
201 - 250 of 2713 citations for 5 Bromo 2 bromo difluoro methyl 1H benzimidazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 300 mM NaCl and 2 mM β -mercaptoethanol) per 5 × 108 cells in the presence of EDTA-free anti-protease cocktail (complete from Roche). Lysis was performed with two cycles of freezing (− 180 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... of siCon or siRictor NIH3T3 cells co-expressing Flag-NDRG1 WT were homogenized in 2% SDS + 5 mM DTT to retrieve proteins in solution supplemented with complete EDTA-free protease inhibitor (Roche, 11873580001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% TritonX-100, 0.5% Na-DOC, 1 mM EDTA, 2 mM PMSF and 1x Roche protease inhibitor cocktail). After sonification for 5 min and clarification with centrifuge at 16,000 g at 4 °C ...
-
bioRxiv - Genomics 2021Quote: ... on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol in MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 300 mM MgAc ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 μL of each primer (100mM stock) (Table SI-4) and 5 μL of 2× KAPA SYBR Fast Universal qPCR kit (KAPA Biosystems, USA). Samples were cycled (40 cycles ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellets were lysed in 200μL of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in buffer F (20 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 2 mM EGTA and Roche cOmplete protease inhibitor) and lysed by fluidizer ...
-
bioRxiv - Cell Biology 2022Quote: ... and then homogenized on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol with MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 3 mM MgAc ...
-
bioRxiv - Biophysics 2021Quote: ... Cell pellets were resuspended in Lysis Buffer (25 mM HEPES pH 8.0, 250 mM NaCl, 10 mM imidazole pH 8.0, 5 mM 2-mercaptoethanol, 10% glycerol and supplemented with Roche cOmplete protease inhibitor) and sonicated ...
-
bioRxiv - Physiology 2023Quote: ... autofluorescence was quenched by treating paraffin-embedded sections with PBS/BSA (5%) for 2 h before performing TUNEL staining (Roche, Basel, Switzerland) according to the manufacturer’s protocol and using Proteinase K treatment ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pellet was resuspended in Buffer B (10 mM Pipes, 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 2 mM PMSF, Roche protease inhibitor) with 1% Triton X-100 and incubated on ice for 1 hour ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µl of the samples’ cDNA was mixed with 5 µl of FastStart SYBR Green Master (ROX; Hoffmann-La Roche, Basel, Switzerland), 0.25 µl of each primer (final concentration 500 nM) ...
-
bioRxiv - Physiology 2023Quote: ... the slides were placed in the terminal dUTP-nick-end labelling (TUNEL) solution (labelling with either fluorescein or tetra-methyl-rhodamine; Roche Diagnostics GmbH, Mannheim, Germany) in 37°C for 1 h and covered in Vectashield with DAPI (Vector ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl of 5 x KAPA HiFi buffer (Roche, #KK2101) and 16.75 µl H2O ...
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5% Triton X-100, 10 mM N-methyl maleimide (general DUB inhibitor diluted in DMSO, freshly added) and protease inhibitors (Roche Diagnostics, EDTA-free, freshly added). Then ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM PMSF (Roche), 10% glycerol ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 5 mM Imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM Imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 5 mM imidazole supplemented with EDTA-free protease inhibitor (Roche) and lysed by ultrasonication ...
-
bioRxiv - Developmental Biology 2021Quote: ... Planarians were blocked in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx [0.1 M Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... transferrin (5 μg/mL) and sodium selenite (5 ng/mL) (Roche Diagnostics, Germany), 100 units/mL of penicillin ...
-
bioRxiv - Developmental Biology 2023Quote: ... Planarians were blocked in Blocking Solution (5% heat inactivated horse serum, 5% Roche Western Blocking Buffer in TNTx [0.1 M Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% CHAPS (Roche), supplemented with 2 mM freshly prepared dithiothreitol ...
-
bioRxiv - Cancer Biology 2024Quote: ... (2) trastuzumab (Roche) treatment (10mg/kg ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.2 mM EDTA, 25% glycerol, 0.42 M NaCl, 2 mM beta-mercaptoethanol, 0.01% IGEPAL CA-630, 2× Roche cOmplete protease inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Neuroscience 2020Quote: ... 40 mM KCl, 5 mM EGTA, 5 mM MgCl2, 5 mM DTT, 1 mM PMSF, 1% Triton X, protease inhibitor Roche complete, pH 7.2) and sonicated at low power for 5 s ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets of harvested bacteria were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...