Labshake search
Citations for Roche :
201 - 250 of 871 citations for 5α CHOLESTAN 3 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... at one end through biotin-streptavidin interactions and to the anti-digoxigenin (Roche, Basel, Switzerland) coated coverglass surface at the other end through digoxigenin-antibody interactions ...
-
bioRxiv - Bioengineering 2022Quote: ... with the addition of one tablet of cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche), 1 unit of Pierce Universal Nuclease and 10 μg of lysozyme ...
-
bioRxiv - Microbiology 2019Quote: ... 1 mM DTT) containing Complete™ Protease Inhibitor Cocktail (one tablet per 50 mL) (Roche) and disrupted by sonication (Branson Digital Sonifier ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with one EDTA-free protease inhibitor mini tablet / 5 ml of buffer (Roche #4693159001). Lysates were incubated on ice for 15 min ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mg/mL DNAse and one complete mini EDTA-free protease inhibitor cocktail tablet (Roche), by passing the sample three times through a pressurised cell disruptor (M110-L ...
-
bioRxiv - Biophysics 2021Quote: ... The resuspended cells were incubated on ice with one Complete EDTA-free protease inhibitor (Roche) tablet as well as with 100 U of DNAse (ArcticZymes ...
-
bioRxiv - Microbiology 2022Quote: ... one of which was treated with 2 U of PNGase F (Roche Cat. Nr. 11365177001) at 37 °C for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... at 1:1,000 dilution in 1% BSA in PBS and One-step ABTS substrate (Roche). Non-PfCSP reactive antibody ...
-
bioRxiv - Synthetic Biology 2021Quote: ... with 8 mL water plus one cOmplete™ Mini EDTA-free 11836170001 (Roche, Basel, Switzerland) protease inhibitor tablet) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10% glycerol) containing 0.1% NP-40 and one EDTA-free cOmplete protease inhibitor tablet (Roche). Cells were lysed by sonication and cleared by centrifugation for 1 h at 30,000xg ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μL Turbo nuclease (Accelagen) and one tablet of Complete EDTA-free protease inhibitor (Roche) (Cormier et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA prepared from these RNA isolations by KAPA SYBR® FAST One-Step kit (Roche) was analyzed directly by qPCR in Real-time PCR cycler RotorGene 3000 (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... pH 7.4 StlC) and with the addition of one tablet cOmplete Protease Inhibitor Cocktail (Roche) and lysozyme incubated for 20-50 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... 25 mM Imidazole) supplemented with one complete EDTA-free protease inhibitor tablet (Roche, Basel, Switzerland), 0.1 mg/ml lysozyme ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM PMSF) supplemented with one protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Plant Biology 2023Quote: ... pH 7.4) with one dissolved tablet of EDTA-free cOmplete (Roche Diagnostics GmbH, Mannheim, Germany). Cell were incubated with 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Biochemistry 2021Quote: ... 25 mM imidazole) supplemented with 1 mM PMSF and one tablet of complete EDTA free (Roche). After sonication at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... Cells were pelleted at 3,000 g during 5 min and washed three times with 1 ml Buffer A (15 mM Tris pH 7.5, 80 mM KCl, 0.1 mM EGTA, 0.2 mM spermine, 0.5 mM spermidine, one tablet Roche cOmplete EDTA-free mini protease inhibitors ...
-
bioRxiv - Biophysics 2019Quote: ... and one tablet of Complete mini EDTA-free protease inhibitor cocktail (Roche; 10 ml, pH 7.4) with up to seven strokes at 700 rpm in a Teflon glass homogenizer ...
-
bioRxiv - Systems Biology 2020Quote: ... One microliter of this suspension was used for colony PCR (KAPA2G Robust HotStart PCR Kit, Roche). Samples with a small amplicon size were considered positive hits ...
-
bioRxiv - Systems Biology 2020Quote: ... One microliter of this suspension was used for colony PCR (KAPA2G Robust HotStart PCR Kit, Roche), whereby a ∼500-bp amplicon was amplified by a primer pair in which the 3’ end of one primer was complementary to the mutant allele ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 8.5 and 1x protease inhibitor (one cocktail tablet [Roche] per 10 mL of lysis buffer). Lysates were first sonicated for 6 cycles of 30 sec on/30 sec off under low power setting with Bioruptor™ Twin (Diagenode) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM DTT and complete EDTA-free protease inhibitor tablets (one tablet/50 mL buffer) (Roche)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... One-step quantitative real-time PCR was performed on a Lightcycler 480 II PCR system (Roche) by using SYBR Green qPCR SuperMix (Bio-rad) ...
-
bioRxiv - Biophysics 2020Quote: ... 10 mM Imidazole pH 8.0) supplemented with one tablet EDTA-free protease inhibitor cocktail (Roche Diagnostics) and 1 mM PMSF (SigmaAldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... and one tablet of Complete mini EDTA-free protease inhibitor cocktail (Roche; 10 ml, pH 7.4)) with up to seven strokes in a Teflon glass motor driven homogenizer at 700 rpm ...