Labshake search
Citations for Roche :
201 - 250 of 4319 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 5 µl of X-tremeGENE 9 transfection reagent (XTG9-RO Roche, Sigma-Aldrich). Three days after transfection ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mg/mL DNAase (Roche, 04716728001). The cells were resuspended by mechanical agitation through Pasteur pipettes flamed with decreasing diameters ...
-
bioRxiv - Genetics 2023Quote: ... with 6-8 cycles of PCR amplification using KAPA-HiFi (Kapa Biosystems, KK2602). DNA library was sequenced using an Illumina NextSeq 500 75-cycle high output kit.
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Synthetic Biology 2021Quote: ... with 8 mL water plus one cOmplete™ Mini EDTA-free 11836170001 (Roche, Basel, Switzerland) protease inhibitor tablet) ...
-
bioRxiv - Neuroscience 2020Quote: ... 100mg of frontal cortex tissue (Brodmann area 8/9) were thawed and homogenized in 500μl of PBS with protease inhibitor (Roche) by 30 up and down strokes in a glass Dounce homogenizer ...
-
bioRxiv - Neuroscience 2020Quote: ... with 0.34 mg/ml nitroblue tetrazolium (NBT) and 0.35 mg/ml 5-bromo-4-chloro-3indolyl-phosphate (BCIP; Roche), for 1–12 hours at room temperature with gentle agitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µl cDNA and 5 µl of LightCycler 480 SYBR Green I Master mix (Roche Diagnostics GmbH, Germany). Three technical replicates of each sample were included ...
-
bioRxiv - Genetics 2021Quote: ... 6-diamidino-2-phenylindole (Hoechst; Roche, Rotkreuz, Switzerland) for nuclei ...
-
bioRxiv - Immunology 2020Quote: ... cells were cotransfected with both the reporter gene and one of the different putative transcription factors using X-tremeGENE 9 (Roche) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... and 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) (pH 8.0) and the presence of Complete® protease inhibitor (Roche). The preparation was centrifuged for 10 min at 2500 rpm and 4 °C and supernatant was transferred to a new tube and centrifuged for 40 min at 30,000 x g and 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... 10-12 DRGs per donor were disintegrated into micro tissue units using 6 mL collagenase P (4 mg/mL, Roche, Mannheim, DE) in a 15 mL Falcon tube on an orbital shaker for 2 h at 37 °C ...
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to the 3-4 ml of digestion media containing 0.1 mg/ml liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... They were then blocked in PBS with 3% BSA for 3h at RT and incubated overnight at 4°C with a peroxidase-labeled anti-DIG antibody (Roche) diluted 1:1500 in PBS with 3% BSA ...
-
bioRxiv - Cell Biology 2022Quote: ... Analysis was performed on either an LSRII 3 or 4-laser flow cytometer (Becton Dickinson) or Attune Acoustic Flow Cytometer (Roche). Post analysis was performed using either FACSDiva (BD) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was hybridized with a TAA(CCCTAA)4 probe which was conjugated with digoxigenin (DIG oligonucleotide 3⍰-end labelling kit, Roche) and signal was revealed using the anti-DIG-alkaline phosphatase antibodies (Roche ...
-
bioRxiv - Bioengineering 2023Quote: ... SOS1•RAS complex was formed by incubating SOS1 and RAS at a stochiometric ratio of 1:3 overnight at 4° with 20 mM EDTA and alkaline phosphatase (Roche). The complex was then purified by gel filtration ...
-
bioRxiv - Cell Biology 2024Quote: ... the digestion with 3 mg/mL type I collagenase was performed in parallel to and compared with 3 mg/mL type I collagenase + 4 mg/mL type II Dispase (Roche), 250 μg/mL Liberase DL (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Physiology 2024Quote: ... and 5 μg/mL glucose-6-phosphate dehydrogenase (Roche)) was added to each well ...
-
bioRxiv - Cell Biology 2022Quote: ... before being detached with 40 μL of ice-cold native lysis buffer (80 mM PIPES pH 6.9, 2 mM MgCl2, 4 mM EGTA, 0.2% saponin, 5x cOmplete protease inhibitor cocktail Roche). The lysate was collected in 1.5 mL tube and incubated on ice for 10 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 mM NaCl, 4 mM MgCl2, 2 mM DTT, 1% SDS, 0.5% sodium deoxycholate, 0.5% Igepal, supplemented with Roche Complete Protease Inhibitor cocktail (1 tablet/50 mL)) ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 μl of PCR-grade water (Roche), 1 μl of the corresponding primer pair (10 μM each ...
-
bioRxiv - Neuroscience 2021Quote: ... 4°C) supplemented with protease (Roche, #11697498001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 μg/ml Laminin (Roche Basel, Switzerland), and 2 μg/ml Fibronectin (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: Virus stocks were generated by transfection of 293T cells with each plasmid clone of HSIV-vif using Fugene 6 or X-tremeGENE 9 DNA transfection reagent according to the manufacturer’s protocol (Roche). Infectious titers were determined by limiting dilution infection analysis using TZM-bl indicator cells and the amount of virus in supernatants was measured by HIV-1 p24gag antigen ELISA (Advanced Bioscience Laboratories).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 30 mM mgCl2 x 6 H2O and 5 mg/mL glucose-6-phosphate dehydrogenase (Roche Diagnostics) in 0.1 M potassium phosphate buffer pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in a protoplast buffer (100 mM Tris-HCl pH 7.5, 2 mM MgCl2, 1M Sucrose, 6 μg/mL of DNAse/ RNAse, 1x protein inhibitor Roche, 800 U mutanolysin, 8 mg/ml lysozyme) and incubated at 30°C for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... Epidermal and dermal sheets were prepared after incubation overnight at 4°C with 4 U/ml dispase II (Roche) in PBS by gently separating dermis and epidermis each as intact sheets (Rahn et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 mM ATP) using one Protease Inhibitor Cocktail Tablet (Roche) per 100 mL of the lysate ...
-
bioRxiv - Molecular Biology 2023Quote: SDGC-SEC-purified stress granule cores (strain JD1370) were incubated at 0.23 A260 units/mL with 2 or 4 units of RNase H (10786357001; Roche) in 40 μL of RNase H buffer (20 mM HEPES-KOH pH 8.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 9 µl of qPCR reaction mix containing 5 ul LightCycler 480 Probes Master (Roche, Cat#04707494001), 3.4 ul of Nuclease Free H2O (Ambion ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... Incubation of primary antibodies was performed overnight at 4 °C in 5% non-fat dry milk or 3.5% BSA (Roche, 10735086001). After three washes in PBS-T ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with 250-800 ng DNA per well of a 12-well plate or 500 ng per well of a 6-well plate using X-tremeGENE 9 DNA transfection reagent (Roche), and harvested after 24 h.
-
bioRxiv - Neuroscience 2021Quote: ... COS-7 cells were plated in 6-well plates (100,000 cells/well) and transfected the next day using X-tremeGENE™ 9 DNA (Transfection Reagent, Roche), with HA-NLGN1 + AP-MDGA1 or AP-MDGA2 + BirAER (1 μg/well) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected with 1 µg of shRNA/cDNA and 1 µg of viral packaging plasmids (250 ng pMD2.G and 750 ng psPAX2) using 6 µl of Xtreme Gene 9 transfection reagent (Roche). After 24 hours of transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Rap1GAP- RlucII/rGFP-CAAX + Gαi2 and D2 or PDZ-RhoGEF-RlucII/rGFP-CAAX + Gα13 and TPαR) using X-tremeGENE 9 DNA transfection reagent (3:1 reagent/DNA ratio; Roche) diluted in OptiMEM (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: ... PFN1-KO or PFN2-KO) were split 1:3 and the next day transfected using XtremeGene 9 (Roche) with 5 μg V5-NAA80 (M23L ...