Labshake search
Citations for Roche :
2401 - 2450 of 6869 citations for Roundabout Guidance Receptor 1 ROBO1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... followed by tissue digestion for 1 h at 37°C with Iscov’s digestion media containing 1 mg/ml Liberase TL (Roche), and 0.5 mg/ml DNAse (Thermo ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were resuspended in a 1:1 ratio (w/v) in PB supplemented with Complete Protease Inhibitor Cocktail (Roche) and afterward dropwise frozen in liquid nitrogen before lysed in 6875D LARGE FREEZER/MILL (SPEX SamplePrep LLC) ...
-
bioRxiv - Microbiology 2022Quote: ... Lysates were prepared by resuspending cell pellets in 2 mL NP-40 buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 1 mM PMSF, 1x PhosSTOP [Roche]), sonication on ice (5s on/10s off for 2 mins at 40% amplitude) ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were incubated in staining solution (1 M Tris-HCl pH 9.5, 5 M NaCl, 1 M MgCl2, NBT-BCIP, H2O) (Roche) in the dark for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... The tissue was digested for 45-60’ at 37°C in a Thermomixer at 800 rpm in 1 mL of 1× PBS + 0.5 mM CaCl2 + 250 μg/mL Liberase (Roche) + 2 mg/mL of Collagenase (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... and incubated overnight with primary antibody in 3% BSA/TBS-T (monoclonal mouse anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG, RRID:AB_262044 or monoclonal mouse anti-GFP, 1:1,000, Roche #11814460001, RRID:AB_390913) at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse atria were minced and digested with mild agitation for 30 minutes at 37°C in DMEM containing 1% P/S and 0.14 Wunsch U ml-1 Liberase (5401119001, Roche). MAFs were enriched via negative selection with magnetic beads against mouse CD45 (leukocytes) ...
-
bioRxiv - Biochemistry 2023Quote: ... Mitochondrial pellets were solubilized in lysis buffer with 1 % digitonin (25 mM HEPES pH 7.5, 150 mM NaCl, 5 % glycerol, 1 mM TCEP, supplemented with PhosStop (Roche), cOmplete protease inhibitor cocktail EDTA-free (Roche) ...
-
bioRxiv - Cell Biology 2023Quote: 12-16 hours old embryos were collected and lysed in homogenization buffer (25 mM Hepes pH 7.4; 150mM NaCl; 0.5mM EDTA pH 8.0; 1 mM DTT and 1 tablet of proteinase inhibitor cocktail; Roche 11836170001). The aqueous phase of the lysate was collected after 1 hour of centrifugation at 4°C and centrifuged again for 25 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... The pellet was washed twice with 300 μl sodium phosphate buffer (20 mM Na-phosphate pH 6.8, 1 mM PMSF, 1× Mini Protease Inhibitor Cocktail, Roche) with centrifugation at 16,000g for 20 min between washes ...
-
bioRxiv - Cell Biology 2023Quote: Cell lysates were prepared in a lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, EDTA-free protease inhibitor cocktail [19543200; Roche]). After centrifugation at 17,700 × g for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... and resuspended in lysis buffer (50 mM PBS pH 7.4, 1 mM EDTA, 5% glycerol, 1 mM PMSF and protease inhibitors from Roche). Cell lysis and protein extraction was achieved through mechanical lysis using glass beads and Precellys®24 Homogenizer (3 cycles of 30 seconds at 5500 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... 140 mM NaC1, 1 mM EDTA, 10% glycerol, 0.1% NP-40, 1 mM PMSF, and 1x protease inhibitor cocktail [Complete; Roche]). The cell pellet was flash frozen in liquid nitrogen with 1.5 mL of lysis buffer and grounded in a Spex Freezer Mill 6775 to a fine powder ...
-
bioRxiv - Microbiology 2023Quote: 293T cells transfected with pCAG AcGFP-FOS or pCAG AcGFP-JEVcore-FOS were incubated for 48 h and lysed in lysis buffer (20 mM Tris-HCl [pH = 7.4], 135 mM NaCl, 1% Triton X-100, 1% glycerol, and protease inhibitor cocktail tablets [Roche]). The cell lysates were incubated with Strep-Tactin Sepharose (IBM GmbH ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single cell suspension was obtained by digesting DRGs in Collagenase type 1 and Dispase II (1 mg/ml; Roche) at 37°C for 70 min18 ...
-
bioRxiv - Physiology 2024Quote: ... Pellets were resuspended with binding buffer (100 mM HEPES, 1 mM EDTA, 1% SDS, pH 7.4, and protease inhibitor cocktail from Roche) by vortexing for 20 min at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... Cells were lysed in RIPA buffer (50 mM Tris HCL, 150 mM NaCl, 1% SDS, 0.5% Na-deoxycholate, 1× Complete protease inhibitor (Roche)) for 30 min on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... Coverslips were incubated with CENP-B box probe-Cy3 (PNAbio) 1:1 in hybridization buffer (20mM Tris, pH 7.4, 60% formamide, 0.5% of blocking reagent (Roche 11096176001)) ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with HRP-conjugated rabbit anti-sheep antibodies and detection using ECL reagents (Roche Diagnostic GmbH). A series of timed exposures were undertaken to ensure that densitometric analyses were performed at exposures within the linear range ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal mouse anti-HA (MMS-101R; Covance) or monoclonal mouse anti-GFP antibodies (11–814–460-001; Roche) prior to secondary antibody treatment with polyclonal goat anti-mouse conjugated to horseradish peroxidase (115–035-146 ...
-
bioRxiv - Cell Biology 2019Quote: Antibodies used for immunofluorescence (IF) experiments in this study were: HA tag (Roche, 3F10/11 867 423 001), giantin (Santa Cruz ...
-
bioRxiv - Molecular Biology 2019Quote: ... and were then stained with the mouse monoclonal antibody against the human P16 protein (Ventana Roche-E6H4, USA) and the FITC-tagged secondary antibody ...
-
bioRxiv - Cancer Biology 2020Quote: ... The expression of KZFP was verified by western blotting with the HA-specific antibody (Roche, Basel, Switzerland; #12013819001). Empty vector-transduced A549 cells (referred to as negative control cells (NC cells) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... An anti-DIG antibody conjugated to alkaline phosphatase and BM purple alkaline phosphatase substrate precipitating solution (Merck Roche) were used for staining ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... cell lysate was incubated with agarose beads conjugated with either mouse IgG or mouse anti-GFP antibodies (Roche) for 3h at 4°c under gentle agitation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were hybridized with a digoxigenin (DIG)-tagged antisense mRNA probes detected by an anti-DIG antibody (Roche) and developed in NBT/BCIP (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were then stained for HMGXB4-HA and HMGXB4SUMO -HA using a HA tag antibody (Roche Applied Science) and Fibrillin with Anti-Fibrillin 1 antibody (abcam ...
-
bioRxiv - Microbiology 2020Quote: ... IFAs were carried out on methanol-fixed cells using primary antibodies mouse mAb α-GFP (Roche Diagnostics #11814460001), 1:100 and rabbit α-PfHP1 12 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-cleared supernatant (25µl beads and 200µl supernatant, 30min, 4°C) was first incubated with anti-HA antibody 12CA5 (Roche Life Science ...
-
bioRxiv - Cancer Biology 2021Quote: ... The detection kit for the antibodies is the UltraView DAB detection Kit (Ventana Medical Systems Inc./ Roche Diagnostic). A counter-staining of the nuclei was used for 12 minutes by Hematoxylin ...
-
bioRxiv - Microbiology 2019Quote: ... The HA epitope was detected using horseradish peroxidase (HRP)-conjugated HA antibody (Roche; catalog no. 12013819001 ab 3F10). SAG2 and DP1 were recognized by rabbit polyclonal anti-SAG2 (generated previously (34) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Input and antibody-bound fractions were quantified by real-time PCR amplification with the SYBR Green mixture (Roche) using a LightCycler 480II (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... Anti-DIG antibody conjugated to alkaline phosphatase allowed detection of hybridized riboprobes according to the manufacturer’s instructions (Roche).
-
bioRxiv - Cancer Biology 2020Quote: ... was used to remove excess antibody and amplified C-circles were detected with CDP-Star® kit (Roche). Membranes were imaged with the Odyssey® Fc Imager (LI-COR ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse monoclonal antibodies were used to detect green fluorescent protein (GFP) (Cat#11814460001, clones 7.1 and 13.1, Roche). Rabbit polyclonal anti-Cdc42p antibodies were provided by Dr ...
-
bioRxiv - Plant Biology 2022Quote: ... Hybridized probes were detected by anti-DIG antibodies conjugated with alkaline phosphatase enzyme (anti-DIG-AP) (Roche, Germany). Photographs were captured using an Olympus BX51 compound microscope using a DP74 Olympus camera.
-
bioRxiv - Molecular Biology 2022Quote: ... The enriched FLC-Venus protein was detected by western blot assay with the antibody anti-GFP (11814460001, Roche). Signals were visualized with chemiluminescence (34095 ...
-
bioRxiv - Plant Biology 2024Quote: ... Blots were incubated for three hours in anti-HA High Affinity antibody from rat IgG (clone 3F10; Roche), used at 1:1200 dilution in TBS Tween 20 (0.1% ...
-
bioRxiv - Plant Biology 2024Quote: ... Immunodetection was performed using an anti-DIG antibody coupled to alkaline phosphatase (Anti-Digoxygenin-AP, Fab fragments, Roche), whose activity was detected by the chromogenic method using NBT/BCIP (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... In situ hybridization (ISH) signals were visualized using anti-DIG antibody conjugated with an alkaline phosphatase fragment (Roche) and nitro-blue tetrazolium and 5-bromo-4-chloro-3’-indolyphosphate substrates ...
-
bioRxiv - Genetics 2023Quote: ... Cells were incubated overnight in primary antibodies targeting GFP to stain GFP labelled CTCF or RAD21 (Roche, 11814460001) or SON (abcam ...
-
bioRxiv - Bioengineering 2024Quote: ... His-tagged rhFGFb was detected using a primary anti-HISx6 mouse polyclonal antibody (Roche Molecular Systems, Inc., USA) or anti-FGF polyclonal antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Systems Biology 2023Quote: ... subsequently transferred to polyvinylidene fluoride membranes and probed with the anti-GFP primary antibody (Roche, Mouse monoclonal, #11814460001) and goat AffiniPure anti-mouse IgG (H+L ...
-
bioRxiv - Genomics 2023Quote: ... PGK4b: CGAACGGACGTGAAGAATGTGCGAGA) and KZFP expression was verified via western blot with an anti-HA antibody (ref. 12013819001, Roche) after >48h induction with 1ng/ml doxycycline ...
-
bioRxiv - Immunology 2023Quote: ... in antibody buffer (20 mM HEPES pH 7.5; 150 mM NaCl; 0.5 mM Spermidine; 1X Protease inhibitor cocktail (Roche); 0.05% Digitonin ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used for Western blotting (WB) and immunofluorescence (IF): rat anti-HA (Roche, 11867423001), mouse anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 20% of the elution sample volume was analyzed by western blotting with α-HA tag antibody (#3F10, Roche) for Sly1-HA immunodetection.