Labshake search
Citations for Roche :
2401 - 2450 of 7278 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Chromosome were blocked in PBT containing 0.2% BSA and 5% goat serum and sequentially incubated with primary antibodies (mouse anti-PolII H5 IgM, 1:1000, Abcam, and rat anti-HA MAb 3F10, 1:50, Roche, or rabbit anti-FLAG, 1:1000, SIGMA) followed by incubation with Alexa488- and/or Alexa647-coupled secondary antibodies (Molecular Probes ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mM EDTA, 1 mM DTT, 1 mM MgCl2, 1% digitonin, 6 μg/mL of DNAse/RNAse, 1x protein inhibitor Roche, 8 U mutanolysin, 8 mg/mL lysozyme) and incubated at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11 644 793 001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA (5∼8 μg) for Nanopore sequencing was end-repaired and ligated via a KAPA Hyper Prep Kit (Cat#KR0961, Kapa Biosystems, Wilmington, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Cell Biology 2023Quote: ... and lysis buffer A (50 mM Tris-HCl, 5 mM EDTA, 10 mM NaN3, and Complete™ EDTA-free tablet; Roche Diagnostics, Mannheim, Germany); disrupted with glass beads at 4 °C ...
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... 1 mM EDTA pH 8 and 1 tablet of protease inhibitor cocktail Roche cOmplete (Roche, Basel, Switzerland) and 1 tablet of phosphatase inhibitor PhosSTOP (Roche)) ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 mm EDTA in ddH2O) supplemented with 1:25 cOmplete Protease Inhibitor Cocktail (Roche Diagnostic, catalog #11697498001) and 1:200 PMSF ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% NP-40 for 10 min in the presence of complete protease inhibitor cocktail (Roche, 1:1000) on ice ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% sodium deoxycholate and 1% Triton X-100) supplemented with 1xEDTA-free complete protease inhibitor mixture (Roche) and phosphatase inhibitor cocktails-I ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.5 mM MgCl2) with 1 mM PMSF and 1× EDTA-free protease inhibitor cocktail (PIC, Roche, 11873580001) for 30 min at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... in blocking buffer for 1 hour at room temperature followed by 1 hour of DAPI (Roche, # 33495822) staining ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pellet was then resuspended in HEGX Buffer (20 mM HEPES-KOH, pH 7.2, 0.8M NaCl, 1 mM EDTA, 10% glycerol, 0.2% Triton X-100 and 1 Roche Complete Protease Inhibitor Tablet ...
-
bioRxiv - Genomics 2022Quote: ... 1 μL of 1:10 diluted cDNA was used in a 10 μL SYBR Green (Roche, 04887352001) qPCR reaction on a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 % Nonidet-P 40) supplied with 1 tablet/50 mL c0mplete EDTA-free Protease Inhibitor Cocktail (Roche), per mg cell pellet and rotating on a wheel at 4°C for 15 minutes ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1% NaDOC, 1% Triton X-100, 0.1% SDS, 0.25% sarkosyl, 1 mM DTT, protease inhibitors from Roche). The cells were sonicated on ice to shear DNA to 300-500 bp ...
-
bioRxiv - Immunology 2020Quote: Tissue was harvested and incubated in a digestion cocktail containing 1 mg ml−1 collagenase A (Roche) and 30 μg ml−1 DNase I (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM EGTA and 1% Triton X-100 supplemented with complete EDTA-free protease inhibitor (Roche, 11873580001) and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and incubated for 1 hour at RT with the secondary antibodies together with DAPI (1:5,000; Roche), all diluted in Dako Antibody Diluent ...
-
bioRxiv - Microbiology 2022Quote: ... at a 1:1 ratio in a MagNA Pure 96-well deep-well extraction plate (06241603001, Roche), covered with a MagNA Pure Sealing Foil (06241638001 ...
-
bioRxiv - Cancer Biology 2023Quote: ... fixed sections were rehydrated and incubated with primary antibodies against ER (SP1; 1:1; Roche, Basel, Swiss), GATA3 (L50-823 ...
-
bioRxiv - Physiology 2023Quote: ... pregnant mice were anesthetized (1:1:0.16 Fentannyl [Fentadon, Dechra Vetinary Products UK], Midazolam [Hypnovel®, Roche, UK] and Ketamine [Ketavet ...
-
bioRxiv - Microbiology 2024Quote: ... Lungs were homogenized with 1 mm silica beads in 1 mL PBS using a MagNA Lyser (Roche). Homogenization was carried out at 6,000 rpm for 60 s and chilled on ice for 5 min in-between runs ...
-
bioRxiv - Genetics 2024Quote: ... 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, 0.15 M NaCl, and 1×protease inhibitors, Roche) with slow rotation at 4 °C for 10 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5 % NP-40 supplemented with 1 mM PMSF and 1 Complete Protease Inhibitor Cocktail (Roche, Basel, Switzerland). The beads were washed three times with lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: ... 0.1 uL-1 of 1:20 diluted DNA was mixed with 1X Kapa HIFI Hotstart Readymix (Roche) and 200 nM primers ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by 1 hour antibody incubation (α-GFP, monoclonal mouse antibody, Roche, catalog no. 11814460001, 1:1000). After three washes with TBST for 10 min each ...
-
bioRxiv - Developmental Biology 2024Quote: ... Rabbit anti-ALFA (1:1000, NanoTag Biotechnologies, RRID:AB_3075998) and Mouse anti-HA (1:1000, Roche, RRID: AB_514505) primary antibodies ...
-
bioRxiv - Neuroscience 2024Quote: ... The agarose resin was washed once with high salt buffer (50 mM Tris HCl pH 7.4, 1M NaCl, 1 mM EDTA, 1% Nonidet NP-40, 0.1% SDS, 0.5% Sodium deoxycholate, Roche cOmplete EDTA-free Protease Inhibitor Cocktail and RNase Inhibitor ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting nuclei were resuspended in Wash Buffer (1 mL 1M HEPES pH 7.5, 1.5 mL 5M NaCl, 12.5 µL 2M spermidine, 1 Roche c0mplete Protease Inhibitor EDTA-free tablet with ddH2O to 50 mL ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 1 hour at room temperature and then probed with the HA-tag (Roche: 3F10; 1:4000) in PBS + 0.2% Tween-20 + 5% normal donkey serum overnight at 4°C ...
-
bioRxiv - Genetics 2024Quote: ... 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.1% Na-deoxycholate, 1x Roche Complete Protease inhibitors ...
-
bioRxiv - Microbiology 2020Quote: ... Parasites were extracted into a Triton X-100 buffer (20 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5 mM EDTA, 1% Triton X-100, supplemented with 1× protease inhibitors - Roche). Extracts were incubated on ice for 30 min then clarified by centrifugation at 12,000g for 15 min at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... The supernatant was replaced with RIPA buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM MgCl2, 1% NP-40, 0.5% sodium deoxycholate, 1x complete protease inhibitor [Roche]) including 1% SDS ...
-
bioRxiv - Developmental Biology 2021Quote: Cell pellets were incubated 20 minutes with RIPA lysis buffer (50 mM Tris-HCl pH7.5, 300 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 1X Roche COMPLETE Mini EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2020Quote: ... for Western blot analysis probing for HA and FLAG epitopes using 1° antibody = 1:500 mouse αHA (Roche), or 1:500 mouse αFLAG (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... previously washed three times with RIPA 0.1% SDS (1X PBS, 1% IGEPAL-C630, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 1 mM EGTA and 1X protease inhibitor cocktail; Roche). Anti-FLAG M2 Magnetic Beads (Sigma Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... cells were lysed with RIPA buffer (25 mM Tris HCl [pH 7.6], 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS, protease inhibitor cocktail [Roche]). The lysates were subjected to SDS-PAGE under denaturing conditions in 12% polyacrylamide gels using Bio-Rad Mini PROTEAN electrophoresis system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2020Quote: ... Ground cell pellet was collected and resuspended end-over-end for 1 h in lysis buffer (160 mM HEPES pH 7.5, 400 mM NaCl, 0.25 mM PMSF, 1 Roche cOmplete™ Protease Inhibitor Cocktail tablet ...
-
bioRxiv - Immunology 2022Quote: ... and then minced and dissociated in digestion buffer (RPMI containing collagenase (1 mg ml−1 collagenase D; Roche), DNase I (100 μg ml−1 ...
-
bioRxiv - Neuroscience 2021Quote: ... containing Phosphatase (1 tablet per 3.3ml lysis buffer) and Protease (1 tablet per 16.67ml lysis buffer) inhibitor (Roche cOmplete tablets ...
-
bioRxiv - Microbiology 2020Quote: ... HIV-1 viral load was determined using the COBAS® AmpliPrep/COBAS® TaqMan HIV-1 test (Roche). PBMCs were purified using BD Vacutainer® CPT™ Mononuclear cell preparation tubes (BD Biosciences ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 0.1% SDS, 2 mM EDTA, 1 mM PMSF, Roche protease and phosphate inhibitor cocktails ...
-
bioRxiv - Immunology 2020Quote: ... DNAse I (0.2 mg ml−1 dissolved in PBS) and Liberase (0.65 Wuensch units ml−1, both Roche, dissolved in HBSS supplemented with 8 % FCS) ...
-
bioRxiv - Physiology 2020Quote: ... 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, protease inhibitors [Roche], phosphatase inhibitors [Roche]). Lysates were incubated for 15 minutes on ice and centrifuged twice at 15,000 x g for 20 minutes at 4°C to remove insoluble material ...
-
bioRxiv - Microbiology 2021Quote: ... the cell pellet was suspended in 1 mL of cold lysis buffer (50 mM TRIS-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, 1 tablet of Roche cOmplete Protease inhibitor Cocktail ...